EMAIL THIS PAGE TO A FRIEND

ZNF318

zinc finger protein 318

Synonyms: TZF ZFP318
UniProtKB ID: Q5VUA4, O94796, Q4G0E4, Q8NEM6, Q9UNU8, Q9Y2W9
Gene ID:
chicken(421457) zinc finger protein 318
dog(609493) zinc finger protein 318
Horse(100067383) zinc finger protein 318
domestic cat(101094099) zinc finger protein 318
cow(786496) zinc finger protein 318
sheep(101112430) zinc finger protein 318
Domestic Rabbit(100355459) zinc finger protein 318
naked mole-rat(101714489) zinc finger protein 318
domestic guinea pig(100714592) zinc finger protein 318
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014345 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014345 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014345 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU063711 MISSION® esiRNA esiRNA human ZNF318 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014345 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014345 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157361 predicted 5360
2 SASI_Hs01_00157362 predicted 5162
3 SASI_Hs01_00157363 predicted 6017
4 SASI_Hs01_00157366 predicted 966
5 SASI_Hs02_00345490 predicted 2817
6 SASI_Hs01_00157368 predicted 3210
7 SASI_Hs02_00345491 predicted 2374
8 SASI_Hs02_00345492 predicted 4132
9 SASI_Hs02_00345493 predicted 6222
10 SASI_Hs02_00345494 predicted 3156
11 SASI_Hs01_00157364 predicted 5864
12 SASI_Hs01_00157365 predicted 5785
13 SASI_Hs01_00157367 predicted 4752
14 SASI_Hs01_00157369 predicted 3255
15 SASI_Hs01_00157370 predicted 5702
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014345
ZNF318 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 318
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014345.1-4160s1c1
Sequence:CCGGGCAAGTCATGTTCAGCCACAACTCGAGTTGTGGCTGAACATGACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134392    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014345.1-6937s1c1
Sequence:CCGGGCTACTTGTGAGTGAATCATTCTCGAGAATGATTCACTCACAAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014345.1-2678s1c1
Sequence:CCGGCCATTCCATCACTCATAAGATCTCGAGATCTTATGAGTGATGGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014345.1-5272s1c1
Sequence:CCGGCCACCTCCTCAACTGTTAGATCTCGAGATCTAACAGTTGAGGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160410    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014345.1-7446s1c1
Sequence:CCGGCCTGCCTTAACATTGTTTGAACTCGAGTTCAAACAATGTTAAGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014345.1-6820s1c1
Sequence:CCGGGAGCAGGTAATTGAAGACAATCTCGAGATTGTCTTCAATTACCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014345.1-971s1c1
Sequence:CCGGGCAACTATCGACAGCGTAGAACTCGAGTTCTACGCTGTCGATAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014345.1-1807s1c1
Sequence:CCGGGCTGTAAAGCTAGAATCACTACTCGAGTAGTGATTCTAGCTTTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158681    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014345.1-7031s1c1
Sequence:CCGGGCAGTCAGCATCTTAAAGTAACTCGAGTTACTTTAAGATGCTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014345.1-3247s1c1
Sequence:CCGGGCTGCTTATGAGTATTATGATCTCGAGATCATAATACTCATAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014345
ZNF318 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 318
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014345.1-4160s1c1
Sequence:CCGGGCAAGTCATGTTCAGCCACAACTCGAGTTGTGGCTGAACATGACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134392    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014345.1-6937s1c1
Sequence:CCGGGCTACTTGTGAGTGAATCATTCTCGAGAATGATTCACTCACAAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014345.1-2678s1c1
Sequence:CCGGCCATTCCATCACTCATAAGATCTCGAGATCTTATGAGTGATGGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014345.1-5272s1c1
Sequence:CCGGCCACCTCCTCAACTGTTAGATCTCGAGATCTAACAGTTGAGGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160410    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014345.1-7446s1c1
Sequence:CCGGCCTGCCTTAACATTGTTTGAACTCGAGTTCAAACAATGTTAAGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014345.1-6820s1c1
Sequence:CCGGGAGCAGGTAATTGAAGACAATCTCGAGATTGTCTTCAATTACCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014345.1-971s1c1
Sequence:CCGGGCAACTATCGACAGCGTAGAACTCGAGTTCTACGCTGTCGATAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014345.1-1807s1c1
Sequence:CCGGGCTGTAAAGCTAGAATCACTACTCGAGTAGTGATTCTAGCTTTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158681    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014345.1-7031s1c1
Sequence:CCGGGCAGTCAGCATCTTAAAGTAACTCGAGTTACTTTAAGATGCTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014345.1-3247s1c1
Sequence:CCGGGCTGCTTATGAGTATTATGATCTCGAGATCATAATACTCATAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014345
ZNF318 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 318
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137281    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014345.1-4160s1c1
Sequence:CCGGGCAAGTCATGTTCAGCCACAACTCGAGTTGTGGCTGAACATGACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134392    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014345.1-6937s1c1
Sequence:CCGGGCTACTTGTGAGTGAATCATTCTCGAGAATGATTCACTCACAAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014345.1-2678s1c1
Sequence:CCGGCCATTCCATCACTCATAAGATCTCGAGATCTTATGAGTGATGGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014345.1-5272s1c1
Sequence:CCGGCCACCTCCTCAACTGTTAGATCTCGAGATCTAACAGTTGAGGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160410    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014345.1-7446s1c1
Sequence:CCGGCCTGCCTTAACATTGTTTGAACTCGAGTTCAAACAATGTTAAGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014345.1-6820s1c1
Sequence:CCGGGAGCAGGTAATTGAAGACAATCTCGAGATTGTCTTCAATTACCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014345.1-971s1c1
Sequence:CCGGGCAACTATCGACAGCGTAGAACTCGAGTTCTACGCTGTCGATAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014345.1-1807s1c1
Sequence:CCGGGCTGTAAAGCTAGAATCACTACTCGAGTAGTGATTCTAGCTTTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158681    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014345.1-7031s1c1
Sequence:CCGGGCAGTCAGCATCTTAAAGTAACTCGAGTTACTTTAAGATGCTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014345.1-3247s1c1
Sequence:CCGGGCTGCTTATGAGTATTATGATCTCGAGATCATAATACTCATAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks