EMAIL THIS PAGE TO A FRIEND

ZNF319

zinc finger protein 319

Synonyms: ZFP319
UniProtKB ID: Q9P2F9, Q52LH8
Gene ID:
domestic guinea pig(100720886) zinc finger protein 319
naked mole-rat(101720039) zinc finger protein 319
Domestic Rabbit(100347481) zinc finger protein 319
cow(618783) zinc finger protein 319
sheep(101103914) zinc finger protein 319
Zebrafish(792588) zinc finger protein 319
domestic cat(101087370) zinc finger protein 319
dog(487258) zinc finger protein 319
chicken(427526) zinc finger protein 319
35 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020807 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020807 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020807 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020807 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020807 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122258 predicted 1962
2 SASI_Hs01_00122259 predicted 1643
3 SASI_Hs02_00353985 predicted 917
4 SASI_Hs01_00122260 predicted 2615
5 SASI_Hs01_00122261 predicted 1735
6 SASI_Hs01_00122262 predicted 1474
7 SASI_Hs01_00122263 predicted 2236
8 SASI_Hs01_00122264 predicted 756
9 SASI_Hs01_00122265 predicted 1481
10 SASI_Hs01_00122266 predicted 2766
11 SASI_Hs01_00122267 predicted 2075
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020807
VALIDATED
ZNF319 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 319
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107270    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020807.1-3307s1c1
Sequence:CCGGCCCTGAATTGTGTGAACCAAACTCGAGTTTGGTTCACACAATTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020807.1-1493s1c1
Sequence:CCGGCGTGTGCGAGTTGCATTTCAACTCGAGTTGAAATGCAACTCGCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_020807.1-2238s1c1
Sequence:CCGGGAGCAGCAGTTCAAGTGTGTACTCGAGTACACACTTGAACTGCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020807.1-1096s1c1
Sequence:CCGGTGAAGTGTTCCATCTGTGAAACTCGAGTTTCACAGATGGAACACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020807.1-1834s1c1
Sequence:CCGGGCCAGAAAGGCTTTGACCAATCTCGAGATTGGTCAAAGCCTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020807.1-1490s21c1
Sequence:CCGGCAACGTGTGCGAGTTGCATTTCTCGAGAAATGCAACTCGCACACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020807.1-2091s21c1
Sequence:CCGGGACTGCGAGAAACGCTTCAAGCTCGAGCTTGAAGCGTTTCTCGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244871    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020807.1-3984s21c1
Sequence:CCGGCAACCGTCCCAACTGCTAATTCTCGAGAATTAGCAGTTGGGACGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020807.1-1720s21c1
Sequence:CCGGAGACCGAGGAGCCCTTCAAATCTCGAGATTTGAAGGGCTCCTCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020807.1-1679s21c1
Sequence:CCGGCAAGCAGCAGTACGCACTGATCTCGAGATCAGTGCGTACTGCTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020807
VALIDATED
ZNF319 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 319
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107270    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020807.1-3307s1c1
Sequence:CCGGCCCTGAATTGTGTGAACCAAACTCGAGTTTGGTTCACACAATTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020807.1-1493s1c1
Sequence:CCGGCGTGTGCGAGTTGCATTTCAACTCGAGTTGAAATGCAACTCGCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_020807.1-2238s1c1
Sequence:CCGGGAGCAGCAGTTCAAGTGTGTACTCGAGTACACACTTGAACTGCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020807.1-1096s1c1
Sequence:CCGGTGAAGTGTTCCATCTGTGAAACTCGAGTTTCACAGATGGAACACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020807.1-1834s1c1
Sequence:CCGGGCCAGAAAGGCTTTGACCAATCTCGAGATTGGTCAAAGCCTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020807.1-1490s21c1
Sequence:CCGGCAACGTGTGCGAGTTGCATTTCTCGAGAAATGCAACTCGCACACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020807.1-2091s21c1
Sequence:CCGGGACTGCGAGAAACGCTTCAAGCTCGAGCTTGAAGCGTTTCTCGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244871    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020807.1-3984s21c1
Sequence:CCGGCAACCGTCCCAACTGCTAATTCTCGAGAATTAGCAGTTGGGACGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020807.1-1720s21c1
Sequence:CCGGAGACCGAGGAGCCCTTCAAATCTCGAGATTTGAAGGGCTCCTCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020807.1-1679s21c1
Sequence:CCGGCAAGCAGCAGTACGCACTGATCTCGAGATCAGTGCGTACTGCTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020807
VALIDATED
ZNF319 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 319
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107270    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020807.1-3307s1c1
Sequence:CCGGCCCTGAATTGTGTGAACCAAACTCGAGTTTGGTTCACACAATTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020807.1-1493s1c1
Sequence:CCGGCGTGTGCGAGTTGCATTTCAACTCGAGTTGAAATGCAACTCGCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_020807.1-2238s1c1
Sequence:CCGGGAGCAGCAGTTCAAGTGTGTACTCGAGTACACACTTGAACTGCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020807.1-1096s1c1
Sequence:CCGGTGAAGTGTTCCATCTGTGAAACTCGAGTTTCACAGATGGAACACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020807.1-1834s1c1
Sequence:CCGGGCCAGAAAGGCTTTGACCAATCTCGAGATTGGTCAAAGCCTTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020807.1-1490s21c1
Sequence:CCGGCAACGTGTGCGAGTTGCATTTCTCGAGAAATGCAACTCGCACACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020807.1-2091s21c1
Sequence:CCGGGACTGCGAGAAACGCTTCAAGCTCGAGCTTGAAGCGTTTCTCGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244871    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020807.1-3984s21c1
Sequence:CCGGCAACCGTCCCAACTGCTAATTCTCGAGAATTAGCAGTTGGGACGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020807.1-1720s21c1
Sequence:CCGGAGACCGAGGAGCCCTTCAAATCTCGAGATTTGAAGGGCTCCTCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020807.1-1679s21c1
Sequence:CCGGCAAGCAGCAGTACGCACTGATCTCGAGATCAGTGCGTACTGCTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks