EMAIL THIS PAGE TO A FRIEND

ZNF320

zinc finger protein 320

Synonyms: ZFPL
Species: Human ZNF320(162967)
UniProtKB ID: A2RRD8, Q8NDR6
Gene ID:
Human(162967) Summary: ZNF320 encodes a Kruppel-like zinc finger protein. Members of this protein family are involved in activation or repression of transcription.[supplied by OMIM, Jul 2002]
13 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207333 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207333 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207333 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207333 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207333 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239116 predicted 599
2 SASI_Hs01_00239117 predicted 1291
3 SASI_Hs01_00239118 predicted 605
4 SASI_Hs01_00239119 predicted 1037
5 SASI_Hs01_00239120 predicted 1540
6 SASI_Hs01_00239122 predicted 1661
7 SASI_Hs01_00239121 predicted 1725
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207333
ZNF320 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 320
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207333.1-699s1c1
Sequence:CCGGCTGGAGAGAAACCTTACAGATCTCGAGATCTGTAAGGTTTCTCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207333.1-420s1c1
Sequence:CCGGCCCTTGCATGTCATCATAGAACTCGAGTTCTATGATGACATGCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207333.1-951s1c1
Sequence:CCGGCTGGAGAGAAACTTTACGAATCTCGAGATTCGTAAAGTTTCTCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207333.1-547s1c1
Sequence:CCGGCAAATGTAATGAGTGTGGCAACTCGAGTTGCCACACTCATTACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207333.1-845s1c1
Sequence:CCGGGCAGAACATCAGAGAGTTCATCTCGAGATGAACTCTCTGATGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154986    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207333.1-480s1c1
Sequence:CCGGGCAAGACCTTTAGTCAGACATCTCGAGATGTCTGACTAAAGGTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207333.1-325s1c1
Sequence:CCGGGCATGATTCACACCTGGCAAACTCGAGTTTGCCAGGTGTGAATCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207333.1-575s1c1
Sequence:CCGGGCTCGAAATTCAGTCCTCGTACTCGAGTACGAGGACTGAATTTCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207333.2-626s21c1
Sequence:CCGGTTTGCATTTGCGAAGACATAGCTCGAGCTATGTCTTCGCAAATGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230181    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207333.2-3185s21c1
Sequence:CCGGACTGATACAAATCCGTTATAACTCGAGTTATAACGGATTTGTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219854    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207333.2-4831s1c1
Sequence:CCGGTTGCTTCCCTTGCCCTATTTACTCGAGTAAATAGGGCAAGGGAAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207333.2-603s21c1
Sequence:GTACCGGGGTCAGCTTGAATCAAGATTTCTCGAGAAATCTTGATTCAAGCTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219853    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207333.2-3185s1c1
Sequence:CCGGACTGATACAAATCCGTTATAACTCGAGTTATAACGGATTTGTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207333.2-1543s21c1
Sequence:CCGGATTCACCTTCACACCTTATTACTCGAGTAATAAGGTGTGAAGGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207333.2-1384s21c1
Sequence:CCGGCGTACCTCGCATGTCATCAAACTCGAGTTTGATGACATGCGAGGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207333
ZNF320 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 320
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207333.1-699s1c1
Sequence:CCGGCTGGAGAGAAACCTTACAGATCTCGAGATCTGTAAGGTTTCTCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207333.1-420s1c1
Sequence:CCGGCCCTTGCATGTCATCATAGAACTCGAGTTCTATGATGACATGCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207333.1-951s1c1
Sequence:CCGGCTGGAGAGAAACTTTACGAATCTCGAGATTCGTAAAGTTTCTCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207333.1-547s1c1
Sequence:CCGGCAAATGTAATGAGTGTGGCAACTCGAGTTGCCACACTCATTACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207333.1-845s1c1
Sequence:CCGGGCAGAACATCAGAGAGTTCATCTCGAGATGAACTCTCTGATGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154986    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207333.1-480s1c1
Sequence:CCGGGCAAGACCTTTAGTCAGACATCTCGAGATGTCTGACTAAAGGTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207333.1-325s1c1
Sequence:CCGGGCATGATTCACACCTGGCAAACTCGAGTTTGCCAGGTGTGAATCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207333.1-575s1c1
Sequence:CCGGGCTCGAAATTCAGTCCTCGTACTCGAGTACGAGGACTGAATTTCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207333.2-626s21c1
Sequence:CCGGTTTGCATTTGCGAAGACATAGCTCGAGCTATGTCTTCGCAAATGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230181    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207333.2-3185s21c1
Sequence:CCGGACTGATACAAATCCGTTATAACTCGAGTTATAACGGATTTGTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219854    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207333.2-4831s1c1
Sequence:CCGGTTGCTTCCCTTGCCCTATTTACTCGAGTAAATAGGGCAAGGGAAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207333.2-603s21c1
Sequence:GTACCGGGGTCAGCTTGAATCAAGATTTCTCGAGAAATCTTGATTCAAGCTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219853    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207333.2-3185s1c1
Sequence:CCGGACTGATACAAATCCGTTATAACTCGAGTTATAACGGATTTGTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207333.2-1543s21c1
Sequence:CCGGATTCACCTTCACACCTTATTACTCGAGTAATAAGGTGTGAAGGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207333.2-1384s21c1
Sequence:CCGGCGTACCTCGCATGTCATCAAACTCGAGTTTGATGACATGCGAGGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207333
ZNF320 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 320
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207333.1-699s1c1
Sequence:CCGGCTGGAGAGAAACCTTACAGATCTCGAGATCTGTAAGGTTTCTCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207333.1-420s1c1
Sequence:CCGGCCCTTGCATGTCATCATAGAACTCGAGTTCTATGATGACATGCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207333.1-951s1c1
Sequence:CCGGCTGGAGAGAAACTTTACGAATCTCGAGATTCGTAAAGTTTCTCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207333.1-547s1c1
Sequence:CCGGCAAATGTAATGAGTGTGGCAACTCGAGTTGCCACACTCATTACATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207333.1-845s1c1
Sequence:CCGGGCAGAACATCAGAGAGTTCATCTCGAGATGAACTCTCTGATGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154986    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207333.1-480s1c1
Sequence:CCGGGCAAGACCTTTAGTCAGACATCTCGAGATGTCTGACTAAAGGTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207333.1-325s1c1
Sequence:CCGGGCATGATTCACACCTGGCAAACTCGAGTTTGCCAGGTGTGAATCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207333.1-575s1c1
Sequence:CCGGGCTCGAAATTCAGTCCTCGTACTCGAGTACGAGGACTGAATTTCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207333.2-626s21c1
Sequence:CCGGTTTGCATTTGCGAAGACATAGCTCGAGCTATGTCTTCGCAAATGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230181    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207333.2-3185s21c1
Sequence:CCGGACTGATACAAATCCGTTATAACTCGAGTTATAACGGATTTGTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219854    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207333.2-4831s1c1
Sequence:CCGGTTGCTTCCCTTGCCCTATTTACTCGAGTAAATAGGGCAAGGGAAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207333.2-603s21c1
Sequence:GTACCGGGGTCAGCTTGAATCAAGATTTCTCGAGAAATCTTGATTCAAGCTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219853    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207333.2-3185s1c1
Sequence:CCGGACTGATACAAATCCGTTATAACTCGAGTTATAACGGATTTGTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207333.2-1543s21c1
Sequence:CCGGATTCACCTTCACACCTTATTACTCGAGTAATAAGGTGTGAAGGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207333.2-1384s21c1
Sequence:CCGGCGTACCTCGCATGTCATCAAACTCGAGTTTGATGACATGCGAGGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks