EMAIL THIS PAGE TO A FRIEND

ZNF321P

zinc finger protein 321, pseudogene

Synonyms: ZNF321
Species: Human ZNF321P(399669)
UniProtKB ID: Q8N8H1, B7ZB38, Q68DZ0, Q86SS5
Gene ID:
41 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_203307 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_203307 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_203307 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_203307 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203307 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234339 predicted 499
2 SASI_Hs01_00234340 predicted 658
3 SASI_Hs02_00373244 predicted 642
4 SASI_Hs01_00234341 predicted 765
5 SASI_Hs01_00234342 predicted 718
6 SASI_Hs01_00234343 predicted 702
7 SASI_Hs01_00234344 predicted 820
8 SASI_Hs01_00234345 predicted 591
9 SASI_Hs01_00234347 predicted 659
10 SASI_Hs01_00234346 predicted 801
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203307
ZNF321P MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 321, pseudogene
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203307.1-931s1c1
Sequence:CCGGGCACGTCATCATAGACTTCATCTCGAGATGAAGTCTATGATGACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147092    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203307.1-2159s1c1
Sequence:CCGGCCAGTAAACATACAAAGCCATCTCGAGATGGCTTTGTATGTTTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147196    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203307.1-2154s1c1
Sequence:CCGGCGTCTCCAGTAAACATACAAACTCGAGTTTGTATGTTTACTGGAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148935    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203307.1-1559s1c1
Sequence:CCGGCAAGGGAGATAGTACCTGTATCTCGAGATACAGGTACTATCTCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147979    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203307.1-859s1c1
Sequence:CCGGGCAATTCATACTGGAGAGAATCTCGAGATTCTCTCCAGTATGAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203307.1-559s1c1
Sequence:CCGGGAGAGTGGCAAATCCTTTAATCTCGAGATTAAAGGATTTGCCACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147302    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203307.1-998s1c1
Sequence:CCGGGTCGCAAATCACATCTTGAAACTCGAGTTTCAAGATGTGATTTGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203307.1-550s1c1
Sequence:CCGGCAATGTAATGAGAGTGGCAAACTCGAGTTTGCCACTCTCATTACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203307.1-554s1c1
Sequence:CCGGGTAATGAGAGTGGCAAATCCTCTCGAGAGGATTTGCCACTCTCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203307
ZNF321P MISSION shRNA shRNA Plasmid DNA
zinc finger protein 321, pseudogene
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203307.1-931s1c1
Sequence:CCGGGCACGTCATCATAGACTTCATCTCGAGATGAAGTCTATGATGACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147092    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203307.1-2159s1c1
Sequence:CCGGCCAGTAAACATACAAAGCCATCTCGAGATGGCTTTGTATGTTTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147196    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203307.1-2154s1c1
Sequence:CCGGCGTCTCCAGTAAACATACAAACTCGAGTTTGTATGTTTACTGGAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148935    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203307.1-1559s1c1
Sequence:CCGGCAAGGGAGATAGTACCTGTATCTCGAGATACAGGTACTATCTCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147979    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203307.1-859s1c1
Sequence:CCGGGCAATTCATACTGGAGAGAATCTCGAGATTCTCTCCAGTATGAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203307.1-559s1c1
Sequence:CCGGGAGAGTGGCAAATCCTTTAATCTCGAGATTAAAGGATTTGCCACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147302    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203307.1-998s1c1
Sequence:CCGGGTCGCAAATCACATCTTGAAACTCGAGTTTCAAGATGTGATTTGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203307.1-550s1c1
Sequence:CCGGCAATGTAATGAGAGTGGCAAACTCGAGTTTGCCACTCTCATTACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203307.1-554s1c1
Sequence:CCGGGTAATGAGAGTGGCAAATCCTCTCGAGAGGATTTGCCACTCTCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203307
ZNF321P MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 321, pseudogene
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203307.1-931s1c1
Sequence:CCGGGCACGTCATCATAGACTTCATCTCGAGATGAAGTCTATGATGACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147092    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203307.1-2159s1c1
Sequence:CCGGCCAGTAAACATACAAAGCCATCTCGAGATGGCTTTGTATGTTTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147196    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203307.1-2154s1c1
Sequence:CCGGCGTCTCCAGTAAACATACAAACTCGAGTTTGTATGTTTACTGGAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148935    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203307.1-1559s1c1
Sequence:CCGGCAAGGGAGATAGTACCTGTATCTCGAGATACAGGTACTATCTCCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147979    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_203307.1-859s1c1
Sequence:CCGGGCAATTCATACTGGAGAGAATCTCGAGATTCTCTCCAGTATGAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203307.1-559s1c1
Sequence:CCGGGAGAGTGGCAAATCCTTTAATCTCGAGATTAAAGGATTTGCCACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147302    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203307.1-998s1c1
Sequence:CCGGGTCGCAAATCACATCTTGAAACTCGAGTTTCAAGATGTGATTTGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203307.1-550s1c1
Sequence:CCGGCAATGTAATGAGAGTGGCAAACTCGAGTTTGCCACTCTCATTACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203307.1-554s1c1
Sequence:CCGGGTAATGAGAGTGGCAAATCCTCTCGAGAGGATTTGCCACTCTCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks