EMAIL THIS PAGE TO A FRIEND

ZNF322

zinc finger protein 322

Synonyms: HCG12 ZNF322A ZNF388 ZNF489
UniProtKB ID: Q6U7Q0, A8K1X3, Q0VDH6, Q6B0G2, Q86W72, Q9H5I9
Gene ID:
Human(79692) Summary: ZNF322A is a member of the zinc-finger transcription factor family and may regulate transcriptional activation in MAPK (see MAPK1; MIM 176948) signaling pathways (Li et al., 2004 [PubMed 15555580]
dog(488285) zinc finger protein 322
domestic cat(101087738) zinc finger protein 322
21 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024639 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024639 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024639 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024639 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024639 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049424 predicted 982
2 SASI_Hs01_00049425 predicted 794
3 SASI_Hs01_00049426 predicted 736
4 SASI_Hs01_00049427 predicted 1125
5 SASI_Hs01_00049428 predicted 1085
6 SASI_Hs01_00049430 predicted 1669
7 SASI_Hs01_00049431 predicted 1332
8 SASI_Hs01_00049432 predicted 1216
9 SASI_Hs01_00049433 predicted 1134
10 SASI_Hs02_00357022 predicted 899
11 SASI_Hs01_00049429 predicted 1292
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024639
ZNF322 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 322
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024639.2-1371s1c1
Sequence:CCGGCACATGGAAGAGAAACCACATCTCGAGATGTGGTTTCTCTTCCATGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024639.2-920s1c1
Sequence:CCGGCAGTAGAAGTACAAACCTCATCTCGAGATGAGGTTTGTACTTCTACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024639.2-766s1c1
Sequence:CCGGCGCTTTCAGGACATCAGAGAACTCGAGTTCTCTGATGTCCTGAAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024639.2-1524s1c1
Sequence:CCGGCTTCTTCAACATCAGACAGTACTCGAGTACTGTCTGATGTTGAAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024639.2-559s1c1
Sequence:CCGGAGTGCCTTGAATGCAAGCAAACTCGAGTTTGCTTGCATTCAAGGCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024639.3-1457s21c1
Sequence:CCGGTACTCGGAGTGCCAACCTAATCTCGAGATTAGGTTGGCACTCCGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024639.3-2015s21c1
Sequence:CCGGATCCTCACTCCAACGAGAAATCTCGAGATTTCTCGTTGGAGTGAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024639.3-1537s21c1
Sequence:CCGGACTGTAGCTCAGATCTTATTGCTCGAGCAATAAGATCTGAGCTACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024639.3-1665s21c1
Sequence:CCGGACAGAGGAGCTACACTATAAACTCGAGTTTATAGTGTAGCTCCTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024639
ZNF322 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 322
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024639.2-1371s1c1
Sequence:CCGGCACATGGAAGAGAAACCACATCTCGAGATGTGGTTTCTCTTCCATGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024639.2-920s1c1
Sequence:CCGGCAGTAGAAGTACAAACCTCATCTCGAGATGAGGTTTGTACTTCTACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024639.2-766s1c1
Sequence:CCGGCGCTTTCAGGACATCAGAGAACTCGAGTTCTCTGATGTCCTGAAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024639.2-1524s1c1
Sequence:CCGGCTTCTTCAACATCAGACAGTACTCGAGTACTGTCTGATGTTGAAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024639.2-559s1c1
Sequence:CCGGAGTGCCTTGAATGCAAGCAAACTCGAGTTTGCTTGCATTCAAGGCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024639.3-1457s21c1
Sequence:CCGGTACTCGGAGTGCCAACCTAATCTCGAGATTAGGTTGGCACTCCGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024639.3-2015s21c1
Sequence:CCGGATCCTCACTCCAACGAGAAATCTCGAGATTTCTCGTTGGAGTGAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024639.3-1537s21c1
Sequence:CCGGACTGTAGCTCAGATCTTATTGCTCGAGCAATAAGATCTGAGCTACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024639.3-1665s21c1
Sequence:CCGGACAGAGGAGCTACACTATAAACTCGAGTTTATAGTGTAGCTCCTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024639
ZNF322 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 322
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024639.2-1371s1c1
Sequence:CCGGCACATGGAAGAGAAACCACATCTCGAGATGTGGTTTCTCTTCCATGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024639.2-920s1c1
Sequence:CCGGCAGTAGAAGTACAAACCTCATCTCGAGATGAGGTTTGTACTTCTACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024639.2-766s1c1
Sequence:CCGGCGCTTTCAGGACATCAGAGAACTCGAGTTCTCTGATGTCCTGAAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024639.2-1524s1c1
Sequence:CCGGCTTCTTCAACATCAGACAGTACTCGAGTACTGTCTGATGTTGAAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024639.2-559s1c1
Sequence:CCGGAGTGCCTTGAATGCAAGCAAACTCGAGTTTGCTTGCATTCAAGGCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024639.3-1457s21c1
Sequence:CCGGTACTCGGAGTGCCAACCTAATCTCGAGATTAGGTTGGCACTCCGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024639.3-2015s21c1
Sequence:CCGGATCCTCACTCCAACGAGAAATCTCGAGATTTCTCGTTGGAGTGAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024639.3-1537s21c1
Sequence:CCGGACTGTAGCTCAGATCTTATTGCTCGAGCAATAAGATCTGAGCTACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024639.3-1665s21c1
Sequence:CCGGACAGAGGAGCTACACTATAAACTCGAGTTTATAGTGTAGCTCCTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks