EMAIL THIS PAGE TO A FRIEND

ZNF322P1

zinc finger protein 322 pseudogene 1

Synonyms: ZNF322 ZNF322B
Species: Human ZNF322P1(387328)
Gene ID:
16 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301910 ANTI-ZNF322B (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199005 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199005 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199005 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU111761 MISSION® esiRNA esiRNA human ZNF322A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_199005 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199005 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169703 predicted 465
2 SASI_Hs01_00169704 predicted 285
3 SASI_Hs01_00169705 predicted 220
4 SASI_Hs01_00169706 predicted 1221
5 SASI_Hs01_00169707 predicted 607
6 SASI_Hs01_00169708 predicted 568
7 SASI_Hs01_00169710 predicted 1155
8 SASI_Hs01_00169711 predicted 821
9 SASI_Hs01_00169712 predicted 703
10 SASI_Hs02_00372522 predicted 618
11 SASI_Hs01_00169709 predicted 976
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199005
ZNF322P1 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 322 pseudogene 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422221    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199005.1-1504s21c1
Sequence:CCGGTCCTCACTCCAACGAGAAATCCTCGAGGATTTCTCGTTGGAGTGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199005.1-694s21c1
Sequence:CCGGAGTGGGAAATCAGATCTTATTCTCGAGAATAAGATCTGATTTCCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199005.1-924s1c1
Sequence:CCGGCCTGGAATGTATGAGAAGTTTCTCGAGAAACTTCTCATACATTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199005.1-569s1c1
Sequence:CCGGGCGAGAAACCATATCTATGTACTCGAGTACATAGATATGGTTTCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199005.1-393s1c1
Sequence:CCGGCCACAATTACGAGAAACCTTACTCGAGTAAGGTTTCTCGTAATTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199005.1-503s1c1
Sequence:CCGGGTGACATTTGTGGCAAGAATTCTCGAGAATTCTTGCCACAAATGTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199005.1-1154s1c1
Sequence:CCGGCAGAGGAGCTACACTATAAATCTCGAGATTTATAGTGTAGCTCCTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199005
ZNF322P1 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 322 pseudogene 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422221    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199005.1-1504s21c1
Sequence:CCGGTCCTCACTCCAACGAGAAATCCTCGAGGATTTCTCGTTGGAGTGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199005.1-694s21c1
Sequence:CCGGAGTGGGAAATCAGATCTTATTCTCGAGAATAAGATCTGATTTCCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199005.1-924s1c1
Sequence:CCGGCCTGGAATGTATGAGAAGTTTCTCGAGAAACTTCTCATACATTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199005.1-569s1c1
Sequence:CCGGGCGAGAAACCATATCTATGTACTCGAGTACATAGATATGGTTTCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199005.1-393s1c1
Sequence:CCGGCCACAATTACGAGAAACCTTACTCGAGTAAGGTTTCTCGTAATTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199005.1-503s1c1
Sequence:CCGGGTGACATTTGTGGCAAGAATTCTCGAGAATTCTTGCCACAAATGTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199005.1-1154s1c1
Sequence:CCGGCAGAGGAGCTACACTATAAATCTCGAGATTTATAGTGTAGCTCCTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199005
ZNF322P1 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 322 pseudogene 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422221    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199005.1-1504s21c1
Sequence:CCGGTCCTCACTCCAACGAGAAATCCTCGAGGATTTCTCGTTGGAGTGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199005.1-694s21c1
Sequence:CCGGAGTGGGAAATCAGATCTTATTCTCGAGAATAAGATCTGATTTCCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199005.1-924s1c1
Sequence:CCGGCCTGGAATGTATGAGAAGTTTCTCGAGAAACTTCTCATACATTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199005.1-569s1c1
Sequence:CCGGGCGAGAAACCATATCTATGTACTCGAGTACATAGATATGGTTTCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199005.1-393s1c1
Sequence:CCGGCCACAATTACGAGAAACCTTACTCGAGTAAGGTTTCTCGTAATTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199005.1-503s1c1
Sequence:CCGGGTGACATTTGTGGCAAGAATTCTCGAGAATTCTTGCCACAAATGTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199005.1-1154s1c1
Sequence:CCGGCAGAGGAGCTACACTATAAATCTCGAGATTTATAGTGTAGCTCCTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks