EMAIL THIS PAGE TO A FRIEND

ZNF324

zinc finger protein 324

Synonyms: ZF5128 ZNF324A
UniProtKB ID: O75467, B3KRX1
Gene ID:
cow(100847773) zinc finger protein 324
domestic guinea pig(100728222) zinc finger protein 324
naked mole-rat(101696361) zinc finger protein 324
Domestic Rabbit(100354992) zinc finger protein 324
dog(484224) zinc finger protein 324
Horse(100147682) zinc finger protein 324
domestic cat(101088966) zinc finger protein 324
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014347 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014347 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014347 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU138371 MISSION® esiRNA esiRNA human ZNF324 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014347 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014347 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173706 predicted 2131
2 SASI_Hs01_00173707 predicted 2169
3 SASI_Hs01_00173708 predicted 1915
4 SASI_Hs01_00173709 predicted 1820
5 SASI_Hs01_00173710 predicted 2052
6 SASI_Hs01_00173711 predicted 1867
7 SASI_Hs01_00173712 predicted 266
8 SASI_Hs01_00173713 predicted 1842
9 SASI_Hs01_00173714 predicted 753
10 SASI_Hs01_00173715 predicted 1953
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014347
VALIDATED
ZNF324 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 324
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014347.1-175s1c1
Sequence:CCGGCCGCGTGATGCTAGACAACTTCTCGAGAAGTTGTCTAGCATCACGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014347.1-336s1c1
Sequence:CCGGCCTGGAGTTTGACAGAGGATACTCGAGTATCCTCTGTCAAACTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014347.1-184s1c1
Sequence:CCGGGCTAGACAACTTCGCACTTGTCTCGAGACAAGTGCGAAGTTGTCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014347.1-1691s1c1
Sequence:CCGGGCGAAGGAAACCGAGCCCACTCTCGAGAGTGGGCTCGGTTTCCTTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014347.1-755s1c1
Sequence:CCGGCATCACCGAATGGGTGCAGTTCTCGAGAACTGCACCCATTCGGTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014347.1-628s21c1
Sequence:CCGGACTCACAGAGCATGCGTTGCTCTCGAGAGCAACGCATGCTCTGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014347.1-1793s21c1
Sequence:CCGGTTCCACAGCTAAAGGGCATATCTCGAGATATGCCCTTTAGCTGTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014347.1-1316s21c1
Sequence:CCGGCAGGGCTCCTCGCTCTTTAAGCTCGAGCTTAAAGAGCGAGGAGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014347.1-184s21c1
Sequence:CCGGGCTAGACAACTTCGCACTTGTCTCGAGACAAGTGCGAAGTTGTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014347.1-276s21c1
Sequence:CCGGTTCCCAGTGGAACGGACACAACTCGAGTTGTGTCCGTTCCACTGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014347
VALIDATED
ZNF324 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 324
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014347.1-175s1c1
Sequence:CCGGCCGCGTGATGCTAGACAACTTCTCGAGAAGTTGTCTAGCATCACGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014347.1-336s1c1
Sequence:CCGGCCTGGAGTTTGACAGAGGATACTCGAGTATCCTCTGTCAAACTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014347.1-184s1c1
Sequence:CCGGGCTAGACAACTTCGCACTTGTCTCGAGACAAGTGCGAAGTTGTCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014347.1-1691s1c1
Sequence:CCGGGCGAAGGAAACCGAGCCCACTCTCGAGAGTGGGCTCGGTTTCCTTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014347.1-755s1c1
Sequence:CCGGCATCACCGAATGGGTGCAGTTCTCGAGAACTGCACCCATTCGGTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014347.1-628s21c1
Sequence:CCGGACTCACAGAGCATGCGTTGCTCTCGAGAGCAACGCATGCTCTGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014347.1-1793s21c1
Sequence:CCGGTTCCACAGCTAAAGGGCATATCTCGAGATATGCCCTTTAGCTGTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014347.1-1316s21c1
Sequence:CCGGCAGGGCTCCTCGCTCTTTAAGCTCGAGCTTAAAGAGCGAGGAGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014347.1-184s21c1
Sequence:CCGGGCTAGACAACTTCGCACTTGTCTCGAGACAAGTGCGAAGTTGTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014347.1-276s21c1
Sequence:CCGGTTCCCAGTGGAACGGACACAACTCGAGTTGTGTCCGTTCCACTGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014347
VALIDATED
ZNF324 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 324
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014347.1-175s1c1
Sequence:CCGGCCGCGTGATGCTAGACAACTTCTCGAGAAGTTGTCTAGCATCACGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014347.1-336s1c1
Sequence:CCGGCCTGGAGTTTGACAGAGGATACTCGAGTATCCTCTGTCAAACTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014347.1-184s1c1
Sequence:CCGGGCTAGACAACTTCGCACTTGTCTCGAGACAAGTGCGAAGTTGTCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014347.1-1691s1c1
Sequence:CCGGGCGAAGGAAACCGAGCCCACTCTCGAGAGTGGGCTCGGTTTCCTTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014347.1-755s1c1
Sequence:CCGGCATCACCGAATGGGTGCAGTTCTCGAGAACTGCACCCATTCGGTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014347.1-628s21c1
Sequence:CCGGACTCACAGAGCATGCGTTGCTCTCGAGAGCAACGCATGCTCTGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014347.1-1793s21c1
Sequence:CCGGTTCCACAGCTAAAGGGCATATCTCGAGATATGCCCTTTAGCTGTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014347.1-1316s21c1
Sequence:CCGGCAGGGCTCCTCGCTCTTTAAGCTCGAGCTTAAAGAGCGAGGAGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014347.1-184s21c1
Sequence:CCGGGCTAGACAACTTCGCACTTGTCTCGAGACAAGTGCGAAGTTGTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014347.1-276s21c1
Sequence:CCGGTTCCCAGTGGAACGGACACAACTCGAGTTGTGTCCGTTCCACTGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks