EMAIL THIS PAGE TO A FRIEND

ZNF324B

zinc finger protein 324B

Species: Human ZNF324B(388569)
UniProtKB ID: Q6AW86, B2RTZ6, Q6ZMX8, Q6ZS42
Gene ID:
18 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_371201 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_371201 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_371201 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207395 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207395 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078603 predicted 2210
2 SASI_Hs01_00078605 predicted 2153
3 SASI_Hs01_00078606 predicted 762
4 SASI_Hs02_00373997 predicted 2109
5 SASI_Hs01_00078607 predicted 2046
6 SASI_Hs02_00373998 predicted 2043
7 SASI_Hs02_00373999 predicted 1608
8 SASI_Hs01_00078608 predicted 212
9 SASI_Hs01_00078609 predicted 331
10 SASI_Hs01_00078610 predicted 2019
11 SASI_Hs01_00078602 predicted 2057
12 SASI_Hs01_00078604 predicted 1606
13 SASI_Hs01_00078611 predicted 1870
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_371201
ZNF324B MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 324B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107595    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_371201.1-2827s1c1
Sequence:CCGGCCCTTGTTATGCCTCCTCAATCTCGAGATTGAGGAGGCATAACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371201.1-364s1c1
Sequence:CCGGCCTCGTGTGGTCATTCAACTTCTCGAGAAGTTGAATGACCACACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371201.1-466s1c1
Sequence:CCGGTCCTGGAGTTTGACAGAGGATCTCGAGATCCTCTGTCAAACTCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371201.1-1008s1c1
Sequence:CCGGGTGCAGCAAAGTGTTCGTGAACTCGAGTTCACGAACACTTTGCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371201.1-1732s1c1
Sequence:CCGGCACACCACAGAGAAGACCAATCTCGAGATTGGTCTTCTCTGTGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_371201
ZNF324B MISSION shRNA shRNA Plasmid DNA
zinc finger protein 324B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107595    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_371201.1-2827s1c1
Sequence:CCGGCCCTTGTTATGCCTCCTCAATCTCGAGATTGAGGAGGCATAACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371201.1-364s1c1
Sequence:CCGGCCTCGTGTGGTCATTCAACTTCTCGAGAAGTTGAATGACCACACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371201.1-466s1c1
Sequence:CCGGTCCTGGAGTTTGACAGAGGATCTCGAGATCCTCTGTCAAACTCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371201.1-1008s1c1
Sequence:CCGGGTGCAGCAAAGTGTTCGTGAACTCGAGTTCACGAACACTTTGCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371201.1-1732s1c1
Sequence:CCGGCACACCACAGAGAAGACCAATCTCGAGATTGGTCTTCTCTGTGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_371201
ZNF324B MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 324B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107595    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_371201.1-2827s1c1
Sequence:CCGGCCCTTGTTATGCCTCCTCAATCTCGAGATTGAGGAGGCATAACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371201.1-364s1c1
Sequence:CCGGCCTCGTGTGGTCATTCAACTTCTCGAGAAGTTGAATGACCACACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371201.1-466s1c1
Sequence:CCGGTCCTGGAGTTTGACAGAGGATCTCGAGATCCTCTGTCAAACTCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371201.1-1008s1c1
Sequence:CCGGGTGCAGCAAAGTGTTCGTGAACTCGAGTTCACGAACACTTTGCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371201.1-1732s1c1
Sequence:CCGGCACACCACAGAGAAGACCAATCTCGAGATTGGTCTTCTCTGTGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks