EMAIL THIS PAGE TO A FRIEND

ZNF326

zinc finger protein 326

Synonyms: ZAN75 ZIRD Zfp326 dJ871E2.1
Gene ID:
Zebrafish(571228) zinc finger protein 326
Horse(100061229) zinc finger protein 326
dog(612406) zinc finger protein 326
chicken(424512) zinc finger protein 326
naked mole-rat(101726341) zinc finger protein 326
domestic guinea pig(100716873) zinc finger protein 326
cow(533643) zinc finger protein 326
sheep(101114840) zinc finger protein 326
128 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0118 AQUA Peptide ESVLTATSILNNPIV[K] chicken, cow, dog, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181781 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181781 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181781 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_182975 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182975 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182975 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181781 Rosetta Predictions human pricing
NM_182975 Rosetta Predictions human pricing
NM_182976 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181781 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100942 predicted 527
2 SASI_Hs01_00100943 predicted 1687
3 SASI_Hs01_00100944 predicted 578
4 SASI_Hs01_00100945 predicted 701
5 SASI_Hs01_00100946 predicted 541
6 SASI_Hs01_00100947 predicted 676
7 SASI_Hs01_00100948 predicted 777
8 SASI_Hs01_00100949 predicted 585
9 SASI_Hs01_00100950 predicted 903
10 SASI_Hs01_00100951 predicted 603
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182975 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201207 predicted 479
2 SASI_Hs01_00201208 predicted 452
3 SASI_Hs01_00201209 predicted 297
4 SASI_Hs01_00201210 predicted 409
5 SASI_Hs01_00201213 predicted 345
6 SASI_Hs01_00201214 predicted 274
7 SASI_Hs02_00371137 predicted 436
8 SASI_Hs01_00201215 predicted 415
9 SASI_Hs01_00201216 predicted 439
10 SASI_Hs02_00371138 predicted 205
11 SASI_Hs01_00201211 predicted 452
12 SASI_Hs01_00201212 predicted 453
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182976 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371139 predicted 819
2 SASI_Hs01_00245622 predicted 989
3 SASI_Hs02_00371140 predicted 584
4 SASI_Hs01_00245626 predicted 1002
5 SASI_Hs02_00371141 predicted 344
6 SASI_Hs01_00245627 predicted 1144
7 SASI_Hs02_00371142 predicted 488
8 SASI_Hs01_00245629 predicted 1052
9 SASI_Hs01_00245630 predicted 1366
10 SASI_Hs02_00371143 predicted 765
11 SASI_Hs01_00245623 predicted 2153
12 SASI_Hs01_00245624 predicted 1038
13 SASI_Hs01_00245625 predicted 1168
14 SASI_Hs01_00245628 predicted 1236
15 SASI_Hs01_00245631 predicted 1065
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181781
VALIDATED
ZNF326 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 326
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181781.2-318s1c1
Sequence:CCGGCCCGGAATTGTTGTTGACTATCTCGAGATAGTCAACAACAATTCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181781.2-743s1c1
Sequence:CCGGGCATGAGTGTATGGTGAATAACTCGAGTTATTCACCATACACTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181781.2-416s1c1
Sequence:CCGGCAGTGGAACCTTTATCAAGAACTCGAGTTCTTGATAAAGGTTCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181781.2-901s1c1
Sequence:CCGGGCAGTGTTTATATCCCTGCTTCTCGAGAAGCAGGGATATAAACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157044    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181781.2-1747s1c1
Sequence:CCGGGCTGCTCTTGGGAGTGAATATCTCGAGATATTCACTCCCAAGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181781
VALIDATED
ZNF326 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 326
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181781.2-318s1c1
Sequence:CCGGCCCGGAATTGTTGTTGACTATCTCGAGATAGTCAACAACAATTCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181781.2-743s1c1
Sequence:CCGGGCATGAGTGTATGGTGAATAACTCGAGTTATTCACCATACACTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181781.2-416s1c1
Sequence:CCGGCAGTGGAACCTTTATCAAGAACTCGAGTTCTTGATAAAGGTTCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181781.2-901s1c1
Sequence:CCGGGCAGTGTTTATATCCCTGCTTCTCGAGAAGCAGGGATATAAACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157044    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181781.2-1747s1c1
Sequence:CCGGGCTGCTCTTGGGAGTGAATATCTCGAGATATTCACTCCCAAGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181781
VALIDATED
ZNF326 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 326
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181781.2-318s1c1
Sequence:CCGGCCCGGAATTGTTGTTGACTATCTCGAGATAGTCAACAACAATTCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_181781.2-743s1c1
Sequence:CCGGGCATGAGTGTATGGTGAATAACTCGAGTTATTCACCATACACTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181781.2-416s1c1
Sequence:CCGGCAGTGGAACCTTTATCAAGAACTCGAGTTCTTGATAAAGGTTCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181781.2-901s1c1
Sequence:CCGGGCAGTGTTTATATCCCTGCTTCTCGAGAAGCAGGGATATAAACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157044    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181781.2-1747s1c1
Sequence:CCGGGCTGCTCTTGGGAGTGAATATCTCGAGATATTCACTCCCAAGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182975
VALIDATED
ZNF326 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 326
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182975.2-167s21c1
Sequence:CCGGTCCGCCTGCAGGAATACTTATCTCGAGATAAGTATTCCTGCAGGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182975.2-196s21c1
Sequence:GTACCGGTAATGGAATGGATCGTGATTACTCGAGTAATCACGATCCATTCCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182975.2-234s21c1
Sequence:CCGGGAGGGATGGATCGTGACTATGCTCGAGCATAGTCACGATCCATCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182975.2-518s21c1
Sequence:CCGGTATTACTGGCAGACGTTATTTCTCGAGAAATAACGTCTGCCAGTAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182975.2-281s21c1
Sequence:CCGGTCCATGGATTCCTACCTAAACCTCGAGGTTTAGGTAGGAATCCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182975
VALIDATED
ZNF326 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 326
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182975.2-167s21c1
Sequence:CCGGTCCGCCTGCAGGAATACTTATCTCGAGATAAGTATTCCTGCAGGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182975.2-196s21c1
Sequence:GTACCGGTAATGGAATGGATCGTGATTACTCGAGTAATCACGATCCATTCCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182975.2-234s21c1
Sequence:CCGGGAGGGATGGATCGTGACTATGCTCGAGCATAGTCACGATCCATCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182975.2-518s21c1
Sequence:CCGGTATTACTGGCAGACGTTATTTCTCGAGAAATAACGTCTGCCAGTAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182975.2-281s21c1
Sequence:CCGGTCCATGGATTCCTACCTAAACCTCGAGGTTTAGGTAGGAATCCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182975
VALIDATED
ZNF326 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 326
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182975.2-167s21c1
Sequence:CCGGTCCGCCTGCAGGAATACTTATCTCGAGATAAGTATTCCTGCAGGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182975.2-196s21c1
Sequence:GTACCGGTAATGGAATGGATCGTGATTACTCGAGTAATCACGATCCATTCCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_182975.2-234s21c1
Sequence:CCGGGAGGGATGGATCGTGACTATGCTCGAGCATAGTCACGATCCATCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182975.2-518s21c1
Sequence:CCGGTATTACTGGCAGACGTTATTTCTCGAGAAATAACGTCTGCCAGTAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182975.2-281s21c1
Sequence:CCGGTCCATGGATTCCTACCTAAACCTCGAGGTTTAGGTAGGAATCCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks