EMAIL THIS PAGE TO A FRIEND

ZNF329

zinc finger protein 329

UniProtKB ID: Q86UD4, B3KR32, Q9H9R7
Gene ID:
cow(100138653) zinc finger protein 329
sheep(101118894) zinc finger protein 329
domestic guinea pig(100730719) zinc finger protein 329
naked mole-rat(101699439) zinc finger protein 329
Domestic Rabbit(100339778) zinc finger protein 329
dog(484234) zinc finger protein 329
domestic cat(101087692) zinc finger protein 329
40 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024620 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024620 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024620 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024620 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024620 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209960 predicted 861
2 SASI_Hs01_00209961 predicted 1126
3 SASI_Hs01_00209962 predicted 1900
4 SASI_Hs01_00209963 predicted 629
5 SASI_Hs01_00209964 predicted 1124
6 SASI_Hs01_00209965 predicted 1378
7 SASI_Hs01_00209966 predicted 748
8 SASI_Hs01_00209967 predicted 771
9 SASI_Hs01_00209968 predicted 634
10 SASI_Hs01_00209969 predicted 754
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024620
ZNF329 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 329
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024620.3-756s21c1
Sequence:CCGGATCGTATGAAGGTAAGAATTTCTCGAGAAATTCTTACCTTCATACGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024620.3-789s21c1
Sequence:CCGGTACTCTGAGCTCATCGCTTAACTCGAGTTAAGCGATGAGCTCAGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024620.3-553s21c1
Sequence:CCGGGCCTTACCCAGCTATCCTAAACTCGAGTTTAGGATAGCTGGGTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024620.3-1844s21c1
Sequence:CCGGAGCAACCCATGGAAACATAATCTCGAGATTATGTTTCCATGGGTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024620.3-626s21c1
Sequence:CCGGACCATTCCATGGAAGTTATTCCTCGAGGAATAACTTCCATGGAATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024620.2-281s1c1
Sequence:CCGGCCTGTGATGTAGAAGTGGAAACTCGAGTTTCCACTTCTACATCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024620.2-521s1c1
Sequence:CCGGCAAATGTTAGTGGTCTGGATTCTCGAGAATCCAGACCACTAACATTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024620.2-681s1c1
Sequence:CCGGCCCTGAAAGTGTTAAGTCTTTCTCGAGAAAGACTTAACACTTTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024620.2-1374s1c1
Sequence:CCGGCAACAGAAACTCTCACCTCATCTCGAGATGAGGTGAGAGTTTCTGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024620.2-1122s1c1
Sequence:CCGGCAACCGAAATTCATCCTTAATCTCGAGATTAAGGATGAATTTCGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024620
ZNF329 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 329
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024620.3-756s21c1
Sequence:CCGGATCGTATGAAGGTAAGAATTTCTCGAGAAATTCTTACCTTCATACGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024620.3-789s21c1
Sequence:CCGGTACTCTGAGCTCATCGCTTAACTCGAGTTAAGCGATGAGCTCAGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024620.3-553s21c1
Sequence:CCGGGCCTTACCCAGCTATCCTAAACTCGAGTTTAGGATAGCTGGGTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024620.3-1844s21c1
Sequence:CCGGAGCAACCCATGGAAACATAATCTCGAGATTATGTTTCCATGGGTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024620.3-626s21c1
Sequence:CCGGACCATTCCATGGAAGTTATTCCTCGAGGAATAACTTCCATGGAATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024620.2-281s1c1
Sequence:CCGGCCTGTGATGTAGAAGTGGAAACTCGAGTTTCCACTTCTACATCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024620.2-521s1c1
Sequence:CCGGCAAATGTTAGTGGTCTGGATTCTCGAGAATCCAGACCACTAACATTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024620.2-681s1c1
Sequence:CCGGCCCTGAAAGTGTTAAGTCTTTCTCGAGAAAGACTTAACACTTTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024620.2-1374s1c1
Sequence:CCGGCAACAGAAACTCTCACCTCATCTCGAGATGAGGTGAGAGTTTCTGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024620.2-1122s1c1
Sequence:CCGGCAACCGAAATTCATCCTTAATCTCGAGATTAAGGATGAATTTCGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024620
ZNF329 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 329
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024620.3-756s21c1
Sequence:CCGGATCGTATGAAGGTAAGAATTTCTCGAGAAATTCTTACCTTCATACGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024620.3-789s21c1
Sequence:CCGGTACTCTGAGCTCATCGCTTAACTCGAGTTAAGCGATGAGCTCAGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024620.3-553s21c1
Sequence:CCGGGCCTTACCCAGCTATCCTAAACTCGAGTTTAGGATAGCTGGGTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024620.3-1844s21c1
Sequence:CCGGAGCAACCCATGGAAACATAATCTCGAGATTATGTTTCCATGGGTTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024620.3-626s21c1
Sequence:CCGGACCATTCCATGGAAGTTATTCCTCGAGGAATAACTTCCATGGAATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024620.2-281s1c1
Sequence:CCGGCCTGTGATGTAGAAGTGGAAACTCGAGTTTCCACTTCTACATCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024620.2-521s1c1
Sequence:CCGGCAAATGTTAGTGGTCTGGATTCTCGAGAATCCAGACCACTAACATTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024620.2-681s1c1
Sequence:CCGGCCCTGAAAGTGTTAAGTCTTTCTCGAGAAAGACTTAACACTTTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024620.2-1374s1c1
Sequence:CCGGCAACAGAAACTCTCACCTCATCTCGAGATGAGGTGAGAGTTTCTGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024620.2-1122s1c1
Sequence:CCGGCAACCGAAATTCATCCTTAATCTCGAGATTAAGGATGAATTTCGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks