EMAIL THIS PAGE TO A FRIEND

ZNF32

zinc finger protein 32

Synonyms: KOX30
UniProtKB ID: P17041, Q92951
Gene ID:
domestic cat(101099502) zinc finger protein 32
dog(486784) zinc finger protein 32
cow(512392) zinc finger protein 32
sheep(101121744) zinc finger protein 32
naked mole-rat(101721737) zinc finger protein 32
domestic guinea pig(100734513) zinc finger protein 32
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006973 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006973 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006973 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU045901 MISSION® esiRNA esiRNA human ZNF32 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005368 Rosetta Predictions human pricing
NM_006973 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005368 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148312 predicted 528
2 SASI_Hs01_00148313 predicted 913
3 SASI_Hs01_00148315 predicted 617
4 SASI_Hs01_00148316 predicted 668
5 SASI_Hs01_00148317 predicted 413
6 SASI_Hs02_00304873 predicted 784
7 SASI_Hs01_00148318 predicted 367
8 SASI_Hs01_00148319 predicted 528
9 SASI_Hs01_00148320 predicted 530
10 SASI_Hs01_00148321 predicted 915
11 SASI_Hs01_00148314 predicted 537
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006973 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172019 predicted 489
2 SASI_Hs01_00172020 predicted 869
3 SASI_Hs01_00172022 predicted 570
4 SASI_Hs01_00172023 predicted 621
5 SASI_Hs01_00172024 predicted 370
6 SASI_Hs02_00342707 predicted 741
7 SASI_Hs01_00172025 predicted 323
8 SASI_Hs01_00172026 predicted 484
9 SASI_Hs01_00172027 predicted 489
10 SASI_Hs01_00172028 predicted 872
11 SASI_Hs01_00172021 predicted 500
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006973
VALIDATED
ZNF32 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 32
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006973.2-505s21c1
Sequence:CCGGTTGTTACACATCAACGGATACCTCGAGGTATCCGTTGATGTGTAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006973.2-328s21c1
Sequence:CCGGATTCGAAGACACTACAGGAAGCTCGAGCTTCCTGTAGTGTCTTCGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006973.2-358s21c1
Sequence:CCGGGAGTGAGACAAAGGGTCTATGCTCGAGCATAGACCCTTTGTCTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006973.2-570s21c1
Sequence:CCGGTTCAGTCAACGAGGTAGTCTCCTCGAGGAGACTACCTCGTTGACTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006973.2-741s21c1
Sequence:CCGGAGTCAGAAAGGAAGCTTAATTCTCGAGAATTAAGCTTCCTTTCTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006973.2-651s21c1
Sequence:CCGGAGCTTCAGGAATCAGAGTAACCTCGAGGTTACTCTGATTCCTGAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_006973.1-952s1c1
Sequence:CCGGCCTGAAGAGAAGTTCTCTTTACTCGAGTAAAGAGAACTTCTCTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006973.1-208s1c1
Sequence:CCGGCCCACCACAAATATGACCACTCTCGAGAGTGGTCATATTTGTGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_006973.1-172s1c1
Sequence:CCGGCCCAGAATGTAGCGTTCTTCACTCGAGTGAAGAACGCTACATTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_006973.1-812s1c1
Sequence:CCGGGAATTGTATTCTGCATGGCAACTCGAGTTGCCATGCAGAATACAATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006973.1-596s1c1
Sequence:CCGGGAAACCCTACGAGTGTGCTATCTCGAGATAGCACACTCGTAGGGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006973
VALIDATED
ZNF32 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 32
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006973.2-505s21c1
Sequence:CCGGTTGTTACACATCAACGGATACCTCGAGGTATCCGTTGATGTGTAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006973.2-328s21c1
Sequence:CCGGATTCGAAGACACTACAGGAAGCTCGAGCTTCCTGTAGTGTCTTCGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006973.2-358s21c1
Sequence:CCGGGAGTGAGACAAAGGGTCTATGCTCGAGCATAGACCCTTTGTCTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006973.2-570s21c1
Sequence:CCGGTTCAGTCAACGAGGTAGTCTCCTCGAGGAGACTACCTCGTTGACTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006973.2-741s21c1
Sequence:CCGGAGTCAGAAAGGAAGCTTAATTCTCGAGAATTAAGCTTCCTTTCTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006973.2-651s21c1
Sequence:CCGGAGCTTCAGGAATCAGAGTAACCTCGAGGTTACTCTGATTCCTGAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_006973.1-952s1c1
Sequence:CCGGCCTGAAGAGAAGTTCTCTTTACTCGAGTAAAGAGAACTTCTCTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006973.1-208s1c1
Sequence:CCGGCCCACCACAAATATGACCACTCTCGAGAGTGGTCATATTTGTGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_006973.1-172s1c1
Sequence:CCGGCCCAGAATGTAGCGTTCTTCACTCGAGTGAAGAACGCTACATTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_006973.1-812s1c1
Sequence:CCGGGAATTGTATTCTGCATGGCAACTCGAGTTGCCATGCAGAATACAATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006973.1-596s1c1
Sequence:CCGGGAAACCCTACGAGTGTGCTATCTCGAGATAGCACACTCGTAGGGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006973
VALIDATED
ZNF32 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 32
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006973.2-505s21c1
Sequence:CCGGTTGTTACACATCAACGGATACCTCGAGGTATCCGTTGATGTGTAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006973.2-328s21c1
Sequence:CCGGATTCGAAGACACTACAGGAAGCTCGAGCTTCCTGTAGTGTCTTCGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006973.2-358s21c1
Sequence:CCGGGAGTGAGACAAAGGGTCTATGCTCGAGCATAGACCCTTTGTCTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006973.2-570s21c1
Sequence:CCGGTTCAGTCAACGAGGTAGTCTCCTCGAGGAGACTACCTCGTTGACTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006973.2-741s21c1
Sequence:CCGGAGTCAGAAAGGAAGCTTAATTCTCGAGAATTAAGCTTCCTTTCTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006973.2-651s21c1
Sequence:CCGGAGCTTCAGGAATCAGAGTAACCTCGAGGTTACTCTGATTCCTGAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_006973.1-952s1c1
Sequence:CCGGCCTGAAGAGAAGTTCTCTTTACTCGAGTAAAGAGAACTTCTCTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006973.1-208s1c1
Sequence:CCGGCCCACCACAAATATGACCACTCTCGAGAGTGGTCATATTTGTGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_006973.1-172s1c1
Sequence:CCGGCCCAGAATGTAGCGTTCTTCACTCGAGTGAAGAACGCTACATTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_006973.1-812s1c1
Sequence:CCGGGAATTGTATTCTGCATGGCAACTCGAGTTGCCATGCAGAATACAATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006973.1-596s1c1
Sequence:CCGGGAAACCCTACGAGTGTGCTATCTCGAGATAGCACACTCGTAGGGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks