EMAIL THIS PAGE TO A FRIEND

ZNF331

zinc finger protein 331

Synonyms: RITA ZNF361 ZNF463
UniProtKB ID: Q9NQX6, Q96GJ4
Gene ID:
Human(55422) Summary: This gene encodes a zinc finger protein containing a KRAB (Kruppel-associated box) domain found in transcriptional repressors. A pseudogene of this gene is located on chromosome 17. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Dec 2011]
cow(516156) zinc finger protein 331
domestic guinea pig(100730993) zinc finger protein 331
naked mole-rat(101701475) zinc finger protein 331
dog(414288) zinc finger protein 331
domestic cat(101082706) zinc finger protein 331
87 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018555 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018555 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018555 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079906 Rosetta Predictions human pricing
NM_001079907 Rosetta Predictions human pricing
NM_018555 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079906 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314100 predicted 1333
2 SASI_Hs02_00314101 predicted 1340
3 SASI_Hs02_00314102 predicted 1260
4 SASI_Hs02_00314103 predicted 1133
5 SASI_Hs02_00314104 predicted 1446
6 SASI_Hs02_00314105 predicted 1346
7 SASI_Hs02_00314106 predicted 1520
8 SASI_Hs02_00314107 predicted 639
9 SASI_Hs02_00314108 predicted 785
10 SASI_Hs02_00314109 predicted 1019
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079907 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314110 predicted 1354
2 SASI_Hs02_00314111 predicted 1353
3 SASI_Hs02_00314112 predicted 1282
4 SASI_Hs02_00314113 predicted 1156
5 SASI_Hs02_00314114 predicted 1464
6 SASI_Hs02_00314115 predicted 1366
7 SASI_Hs02_00314116 predicted 1532
8 SASI_Hs02_00314117 predicted 668
9 SASI_Hs02_00314118 predicted 805
10 SASI_Hs02_00314119 predicted 1041
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018555 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045459 predicted 2346
2 SASI_Hs01_00045460 predicted 2352
3 SASI_Hs01_00045461 predicted 2281
4 SASI_Hs01_00045462 predicted 2147
5 SASI_Hs01_00045463 predicted 2454
6 SASI_Hs01_00045464 predicted 2359
7 SASI_Hs01_00045465 predicted 2533
8 SASI_Hs01_00045466 predicted 1657
9 SASI_Hs01_00045467 predicted 1800
10 SASI_Hs01_00045468 predicted 2032
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018555
ZNF331 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 331
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018555.3-1262s1c1
Sequence:CCGGCCTCGTTATTCATAAGAGGATCTCGAGATCCTCTTATGAATAACGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018555.3-2010s1c1
Sequence:CCGGCTAAACCATCTCCGAGAACATCTCGAGATGTTCTCGGAGATGGTTTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018555.3-1683s1c1
Sequence:CCGGCTCGTTAAGCACGAGAGGATACTCGAGTATCCTCTCGTGCTTAACGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018555.3-1083s1c1
Sequence:CCGGCGTGGCTATCAACTTAGTCAACTCGAGTTGACTAAGTTGATAGCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018555.3-1014s1c1
Sequence:CCGGCCTAGAACACATCAGAGACATCTCGAGATGTCTCTGATGTGTTCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018555.5-2843s21c1
Sequence:CCGGAGTAGCCCGCTCGTATCTATGCTCGAGCATAGATACGAGCGGGCTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018555.5-2615s21c1
Sequence:CCGGATGGATCGAGCCTCGTGAAACCTCGAGGTTTCACGAGGCTCGATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018555.5-1733s21c1
Sequence:CCGGTCAATCAGATGATCATCAATTCTCGAGAATTGATGATCATCTGATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413864    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018555.5-3242s21c1
Sequence:CCGGAGGTGAAAGTTCTCAACTTAACTCGAGTTAAGTTGAGAACTTTCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018555
ZNF331 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 331
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018555.3-1262s1c1
Sequence:CCGGCCTCGTTATTCATAAGAGGATCTCGAGATCCTCTTATGAATAACGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018555.3-2010s1c1
Sequence:CCGGCTAAACCATCTCCGAGAACATCTCGAGATGTTCTCGGAGATGGTTTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018555.3-1683s1c1
Sequence:CCGGCTCGTTAAGCACGAGAGGATACTCGAGTATCCTCTCGTGCTTAACGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018555.3-1083s1c1
Sequence:CCGGCGTGGCTATCAACTTAGTCAACTCGAGTTGACTAAGTTGATAGCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018555.3-1014s1c1
Sequence:CCGGCCTAGAACACATCAGAGACATCTCGAGATGTCTCTGATGTGTTCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018555.5-2843s21c1
Sequence:CCGGAGTAGCCCGCTCGTATCTATGCTCGAGCATAGATACGAGCGGGCTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018555.5-2615s21c1
Sequence:CCGGATGGATCGAGCCTCGTGAAACCTCGAGGTTTCACGAGGCTCGATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018555.5-1733s21c1
Sequence:CCGGTCAATCAGATGATCATCAATTCTCGAGAATTGATGATCATCTGATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413864    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018555.5-3242s21c1
Sequence:CCGGAGGTGAAAGTTCTCAACTTAACTCGAGTTAAGTTGAGAACTTTCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018555
ZNF331 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 331
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018555.3-1262s1c1
Sequence:CCGGCCTCGTTATTCATAAGAGGATCTCGAGATCCTCTTATGAATAACGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018555.3-2010s1c1
Sequence:CCGGCTAAACCATCTCCGAGAACATCTCGAGATGTTCTCGGAGATGGTTTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018555.3-1683s1c1
Sequence:CCGGCTCGTTAAGCACGAGAGGATACTCGAGTATCCTCTCGTGCTTAACGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018555.3-1083s1c1
Sequence:CCGGCGTGGCTATCAACTTAGTCAACTCGAGTTGACTAAGTTGATAGCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018555.3-1014s1c1
Sequence:CCGGCCTAGAACACATCAGAGACATCTCGAGATGTCTCTGATGTGTTCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428255    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018555.5-2843s21c1
Sequence:CCGGAGTAGCCCGCTCGTATCTATGCTCGAGCATAGATACGAGCGGGCTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018555.5-2615s21c1
Sequence:CCGGATGGATCGAGCCTCGTGAAACCTCGAGGTTTCACGAGGCTCGATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018555.5-1733s21c1
Sequence:CCGGTCAATCAGATGATCATCAATTCTCGAGAATTGATGATCATCTGATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413864    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018555.5-3242s21c1
Sequence:CCGGAGGTGAAAGTTCTCAACTTAACTCGAGTTAAGTTGAGAACTTTCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks