EMAIL THIS PAGE TO A FRIEND

ZNF333

zinc finger protein 333

UniProtKB ID: Q96JL9, Q8TDL0
Gene ID:
Horse(100064631) zinc finger protein 333
domestic cat(101098523) zinc finger protein 333
dog(484899) zinc finger protein 333
cow(789635) zinc finger protein 333
209 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032433 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032433 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032433 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU129501 MISSION® esiRNA esiRNA human ZNF333 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032433 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032433 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128896 predicted 1268
2 SASI_Hs02_00359838 predicted 886
3 SASI_Hs01_00128897 predicted 384
4 SASI_Hs01_00128898 predicted 1253
5 SASI_Hs01_00128899 predicted 332
6 SASI_Hs02_00359839 predicted 877
7 SASI_Hs01_00128900 predicted 1005
8 SASI_Hs01_00128901 predicted 1756
9 SASI_Hs01_00128902 predicted 575
10 SASI_Hs01_00128903 predicted 1723
11 SASI_Hs01_00128904 predicted 863
12 SASI_Hs01_00128905 predicted 269
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032433
ZNF333 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 333
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432674    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032433.2-2254s21c1
Sequence:CCGGTAACCTCCATTATCGTTTATTCTCGAGAATAAACGATAATGGAGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032433.2-1177s21c1
Sequence:CCGGTCCAGAGTGCCCACCTAATTGCTCGAGCAATTAGGTGGGCACTCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032433.1-842s1c1
Sequence:CCGGGCGTTGTCTTATTTGGAAGAACTCGAGTTCTTCCAAATAAGACAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032433.1-1720s1c1
Sequence:CCGGGAGTCGTCTTTCAACCCTGAACTCGAGTTCAGGGTTGAAAGACGACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032433.1-1386s1c1
Sequence:CCGGCGAGGAACTTTAACCTGATTTCTCGAGAAATCAGGTTAAAGTTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032433.1-170s1c1
Sequence:CCGGCTGTGCAAATACAGGATGCTTCTCGAGAAGCATCCTGTATTTGCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032433.1-1101s1c1
Sequence:CCGGCCTGTGAATGTCAAGAGATTACTCGAGTAATCTCTTGACATTCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032433
ZNF333 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 333
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432674    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032433.2-2254s21c1
Sequence:CCGGTAACCTCCATTATCGTTTATTCTCGAGAATAAACGATAATGGAGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032433.2-1177s21c1
Sequence:CCGGTCCAGAGTGCCCACCTAATTGCTCGAGCAATTAGGTGGGCACTCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032433.1-842s1c1
Sequence:CCGGGCGTTGTCTTATTTGGAAGAACTCGAGTTCTTCCAAATAAGACAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032433.1-1720s1c1
Sequence:CCGGGAGTCGTCTTTCAACCCTGAACTCGAGTTCAGGGTTGAAAGACGACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032433.1-1386s1c1
Sequence:CCGGCGAGGAACTTTAACCTGATTTCTCGAGAAATCAGGTTAAAGTTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032433.1-170s1c1
Sequence:CCGGCTGTGCAAATACAGGATGCTTCTCGAGAAGCATCCTGTATTTGCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032433.1-1101s1c1
Sequence:CCGGCCTGTGAATGTCAAGAGATTACTCGAGTAATCTCTTGACATTCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032433
ZNF333 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 333
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432674    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032433.2-2254s21c1
Sequence:CCGGTAACCTCCATTATCGTTTATTCTCGAGAATAAACGATAATGGAGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032433.2-1177s21c1
Sequence:CCGGTCCAGAGTGCCCACCTAATTGCTCGAGCAATTAGGTGGGCACTCTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032433.1-842s1c1
Sequence:CCGGGCGTTGTCTTATTTGGAAGAACTCGAGTTCTTCCAAATAAGACAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032433.1-1720s1c1
Sequence:CCGGGAGTCGTCTTTCAACCCTGAACTCGAGTTCAGGGTTGAAAGACGACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032433.1-1386s1c1
Sequence:CCGGCGAGGAACTTTAACCTGATTTCTCGAGAAATCAGGTTAAAGTTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032433.1-170s1c1
Sequence:CCGGCTGTGCAAATACAGGATGCTTCTCGAGAAGCATCCTGTATTTGCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032433.1-1101s1c1
Sequence:CCGGCCTGTGAATGTCAAGAGATTACTCGAGTAATCTCTTGACATTCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks