EMAIL THIS PAGE TO A FRIEND

ZNF334

zinc finger protein 334

Species: Human ZNF334(55713), naked mole-rat Znf334(101702358)
UniProtKB ID: Q9HCZ1, Q5T6U2, Q9NVW4
Gene ID:
Human(55713) Summary: This gene encodes a member of the C2H2 zinc finger family. The encoded protein contains a Krueppel-associated box, fourteen C2H2 zinc finger domains, and four C2H2-type/integrase DNA-binding domains. Decreased expression of this gene may be a marker for rheumatoid arthritis. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
naked mole-rat(101702358) zinc finger protein 334
36 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018102 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018102 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018102 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018102 Rosetta Predictions human pricing
NM_199441 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018102 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015210 predicted 1439
2 SASI_Hs01_00015211 predicted 1190
3 SASI_Hs01_00015212 predicted 671
4 SASI_Hs02_00351286 predicted 790
5 SASI_Hs02_00351287 predicted 2227
6 SASI_Hs01_00015214 predicted 413
7 SASI_Hs01_00015215 predicted 1170
8 SASI_Hs01_00015218 predicted 734
9 SASI_Hs02_00351288 predicted 1251
10 SASI_Hs02_00351289 predicted 1919
11 SASI_Hs01_00015209 predicted 844
12 SASI_Hs01_00015213 predicted 1092
13 SASI_Hs01_00015216 predicted 2226
14 SASI_Hs01_00015217 predicted 455
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199441 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047451 predicted 2458
2 SASI_Hs01_00047452 predicted 2215
3 SASI_Hs01_00047453 predicted 1699
4 SASI_Hs02_00372850 predicted 1813
5 SASI_Hs01_00047455 predicted 1440
6 SASI_Hs01_00047456 predicted 2195
7 SASI_Hs01_00047459 predicted 1756
8 SASI_Hs02_00372851 predicted 1519
9 SASI_Hs02_00372852 predicted 2282
10 SASI_Hs02_00372853 predicted 2945
11 SASI_Hs01_00047450 predicted 1875
12 SASI_Hs01_00047454 predicted 2120
13 SASI_Hs01_00047457 predicted 3249
14 SASI_Hs01_00047458 predicted 1486
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018102
ZNF334 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 334
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018102.3-422s1c1
Sequence:CCGGCCAGACATTGATGATGCCTTACTCGAGTAAGGCATCATCAATGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018102.3-1253s1c1
Sequence:CCGGGCCTTCAGCAAGAAATCGTATCTCGAGATACGATTTCTTGCTGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018102.3-552s1c1
Sequence:CCGGGCATGAATAGTGTTCCCTCAACTCGAGTTGAGGGAACACTATTCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018102.3-1597s1c1
Sequence:CCGGCCATAAGTCAACACTCACTATCTCGAGATAGTGAGTGTTGACTTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018102.3-2181s1c1
Sequence:CCGGGCCACAAATCAAACTTTCTTTCTCGAGAAAGAAAGTTTGATTTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018102.3-1512s21c1
Sequence:CCGGGTACGAAATCAGCCCTCATTGCTCGAGCAATGAGGGCTGATTTCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018102.3-1547s21c1
Sequence:CCGGCATAGAGGAAAGAAGTCTTATCTCGAGATAAGACTTCTTTCCTCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018102.3-342s21c1
Sequence:CCGGTTAGCAAACCAGATGTGATTTCTCGAGAAATCACATCTGGTTTGCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018102
ZNF334 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 334
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018102.3-422s1c1
Sequence:CCGGCCAGACATTGATGATGCCTTACTCGAGTAAGGCATCATCAATGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018102.3-1253s1c1
Sequence:CCGGGCCTTCAGCAAGAAATCGTATCTCGAGATACGATTTCTTGCTGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018102.3-552s1c1
Sequence:CCGGGCATGAATAGTGTTCCCTCAACTCGAGTTGAGGGAACACTATTCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018102.3-1597s1c1
Sequence:CCGGCCATAAGTCAACACTCACTATCTCGAGATAGTGAGTGTTGACTTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018102.3-2181s1c1
Sequence:CCGGGCCACAAATCAAACTTTCTTTCTCGAGAAAGAAAGTTTGATTTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018102.3-1512s21c1
Sequence:CCGGGTACGAAATCAGCCCTCATTGCTCGAGCAATGAGGGCTGATTTCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018102.3-1547s21c1
Sequence:CCGGCATAGAGGAAAGAAGTCTTATCTCGAGATAAGACTTCTTTCCTCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018102.3-342s21c1
Sequence:CCGGTTAGCAAACCAGATGTGATTTCTCGAGAAATCACATCTGGTTTGCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018102
ZNF334 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 334
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018102.3-422s1c1
Sequence:CCGGCCAGACATTGATGATGCCTTACTCGAGTAAGGCATCATCAATGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018102.3-1253s1c1
Sequence:CCGGGCCTTCAGCAAGAAATCGTATCTCGAGATACGATTTCTTGCTGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018102.3-552s1c1
Sequence:CCGGGCATGAATAGTGTTCCCTCAACTCGAGTTGAGGGAACACTATTCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018102.3-1597s1c1
Sequence:CCGGCCATAAGTCAACACTCACTATCTCGAGATAGTGAGTGTTGACTTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018102.3-2181s1c1
Sequence:CCGGGCCACAAATCAAACTTTCTTTCTCGAGAAAGAAAGTTTGATTTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018102.3-1512s21c1
Sequence:CCGGGTACGAAATCAGCCCTCATTGCTCGAGCAATGAGGGCTGATTTCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018102.3-1547s21c1
Sequence:CCGGCATAGAGGAAAGAAGTCTTATCTCGAGATAAGACTTCTTTCCTCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018102.3-342s21c1
Sequence:CCGGTTAGCAAACCAGATGTGATTTCTCGAGAAATCACATCTGGTTTGCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks