EMAIL THIS PAGE TO A FRIEND

ZNF335

zinc finger protein 335

Synonyms: MCPH10 NIF-1 NIF1 NIF2
UniProtKB ID: Q9H4Z2, B4DLG7, Q548D0, Q9H684
Gene ID:
Human(63925) Summary: The protein encoded by this gene enhances transcriptional activation by ligand-bound nuclear hormone receptors. However, it does this not by direct interaction with the receptor, but by direct interaction with the nuclear hormone receptor transcriptional coactivator NRC. The encoded protein may function by altering local chromatin structure. [provided by RefSeq, Jul 2008]
chicken(396131) zinc finger protein 335
dog(485904) zinc finger protein 335
Horse(100071131) zinc finger protein 335
domestic cat(101084438) zinc finger protein 335
naked mole-rat(101718844) zinc finger protein 335
domestic guinea pig(100721598) zinc finger protein 335
cow(535476) zinc finger protein 335
sheep(101116753) zinc finger protein 335
45 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2103089 Anti-ZNF335 antibody produced in rabbit affinity isolated antibody bovine, canine, human, horse, rat, guinea pig, rabbit
western blot pricing
HPA063999 Anti-ZNF335 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
HPA071230 Anti-ZNF335 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
PLA0145 Rabbit anti-NIF1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. mouse, rhesus monkey, chimpanzee, gibbon, human, primate, horse, guinea pig, marmoset
immunofluorescence, immunohistochemistry, immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022095 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022095 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022095 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU079361 MISSION® esiRNA esiRNA human ZNF335 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022095 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022095 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355479 predicted 2393
2 SASI_Hs02_00355480 predicted 2744
3 SASI_Hs01_00132549 predicted 1521
4 SASI_Hs02_00355481 predicted 1994
5 SASI_Hs01_00132553 predicted 2859
6 SASI_Hs01_00132554 predicted 1859
7 SASI_Hs02_00355482 predicted 1895
8 SASI_Hs01_00132556 predicted 3567
9 SASI_Hs01_00132557 predicted 378
10 SASI_Hs01_00132558 predicted 330
11 SASI_Hs01_00132550 predicted 2170
12 SASI_Hs01_00132551 predicted 4169
13 SASI_Hs01_00132552 predicted 1461
14 SASI_Hs01_00132555 predicted 4061
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022095
ZNF335 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 335
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022095.3-1467s21c1
Sequence:CCGGGAAATACCGCAAGTACTATTACTCGAGTAATAGTACTTGCGGTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022095.3-2859s21c1
Sequence:CCGGGGTTGTGAGTGACACCCTAAACTCGAGTTTAGGGTGTCACTCACAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022095.3-3890s21c1
Sequence:CCGGAGATCACACACATCCAGTATGCTCGAGCATACTGGATGTGTGTGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022095.3-3399s1c1
Sequence:CCGGGCACATGCTGACTCACACAAACTCGAGTTTGTGTGAGTCAGCATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154712    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022095.3-4256s1c1
Sequence:CCGGGATAGCCAGCATCCTCTCATTCTCGAGAATGAGAGGATGCTGGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022095.3-1075s1c1
Sequence:CCGGGAGGAGGATAGCGACTATAATCTCGAGATTATAGTCGCTATCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022095.3-4228s1c1
Sequence:CCGGCCTCTTCATTTAGGATCTCCACTCGAGTGGAGATCCTAAATGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022095.3-3796s1c1
Sequence:CCGGCAGTATATCATCTCCCAGGATCTCGAGATCCTGGGAGATGATATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022095
ZNF335 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 335
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022095.3-1467s21c1
Sequence:CCGGGAAATACCGCAAGTACTATTACTCGAGTAATAGTACTTGCGGTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022095.3-2859s21c1
Sequence:CCGGGGTTGTGAGTGACACCCTAAACTCGAGTTTAGGGTGTCACTCACAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022095.3-3890s21c1
Sequence:CCGGAGATCACACACATCCAGTATGCTCGAGCATACTGGATGTGTGTGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022095.3-3399s1c1
Sequence:CCGGGCACATGCTGACTCACACAAACTCGAGTTTGTGTGAGTCAGCATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154712    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022095.3-4256s1c1
Sequence:CCGGGATAGCCAGCATCCTCTCATTCTCGAGAATGAGAGGATGCTGGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022095.3-1075s1c1
Sequence:CCGGGAGGAGGATAGCGACTATAATCTCGAGATTATAGTCGCTATCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022095.3-4228s1c1
Sequence:CCGGCCTCTTCATTTAGGATCTCCACTCGAGTGGAGATCCTAAATGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022095.3-3796s1c1
Sequence:CCGGCAGTATATCATCTCCCAGGATCTCGAGATCCTGGGAGATGATATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022095
ZNF335 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 335
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022095.3-1467s21c1
Sequence:CCGGGAAATACCGCAAGTACTATTACTCGAGTAATAGTACTTGCGGTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022095.3-2859s21c1
Sequence:CCGGGGTTGTGAGTGACACCCTAAACTCGAGTTTAGGGTGTCACTCACAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022095.3-3890s21c1
Sequence:CCGGAGATCACACACATCCAGTATGCTCGAGCATACTGGATGTGTGTGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022095.3-3399s1c1
Sequence:CCGGGCACATGCTGACTCACACAAACTCGAGTTTGTGTGAGTCAGCATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154712    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022095.3-4256s1c1
Sequence:CCGGGATAGCCAGCATCCTCTCATTCTCGAGAATGAGAGGATGCTGGCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022095.3-1075s1c1
Sequence:CCGGGAGGAGGATAGCGACTATAATCTCGAGATTATAGTCGCTATCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022095.3-4228s1c1
Sequence:CCGGCCTCTTCATTTAGGATCTCCACTCGAGTGGAGATCCTAAATGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022095.3-3796s1c1
Sequence:CCGGCAGTATATCATCTCCCAGGATCTCGAGATCCTGGGAGATGATATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks