EMAIL THIS PAGE TO A FRIEND

ZNF337

zinc finger protein 337

Species: Human ZNF337(26152)
UniProtKB ID: Q9Y3M9, Q9Y3Y5
Gene ID:
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015655 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015655 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015655 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU080801 MISSION® esiRNA esiRNA human ZNF337 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015655 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015655 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012081 predicted 2325
2 SASI_Hs01_00012082 predicted 2186
3 SASI_Hs01_00012083 predicted 783
4 SASI_Hs01_00012084 predicted 2272
5 SASI_Hs01_00012085 predicted 1418
6 SASI_Hs01_00012086 predicted 1118
7 SASI_Hs01_00012087 predicted 2418
8 SASI_Hs02_00348265 predicted 1445
9 SASI_Hs01_00012088 predicted 569
10 SASI_Hs01_00012089 predicted 932
11 SASI_Hs01_00012090 predicted 2298
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015655
ZNF337 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 337
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015655.2-608s1c1
Sequence:CCGGCCTACAGAAATAGACAAAGTACTCGAGTACTTTGTCTATTTCTGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015655.2-1257s1c1
Sequence:CCGGGCAGGCAGTGTAAGCAAAGTTCTCGAGAACTTTGCTTACACTGCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015655.2-371s1c1
Sequence:CCGGGCAGGAATATATGCAGAACATCTCGAGATGTTCTGCATATATTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015655.2-771s1c1
Sequence:CCGGGCTTTAGAGATGAGTCAGCATCTCGAGATGCTGACTCATCTCTAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015655.2-2292s1c1
Sequence:CCGGGCAATAAGTCATACTACAGTACTCGAGTACTGTAGTATGACTTATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015655.2-1016s21c1
Sequence:CCGGGGGCGAAGGTTTAACGATAAGCTCGAGCTTATCGTTAAACCTTCGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015655.2-1257s21c1
Sequence:CCGGGCAGGCAGTGTAAGCAAAGTTCTCGAGAACTTTGCTTACACTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015655.2-2461s21c1
Sequence:CCGGACTTGTTCGTGAAGATATAACCTCGAGGTTATATCTTCACGAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015655.2-1099s21c1
Sequence:CCGGTGGGCGAGGCTATACTAATAACTCGAGTTATTAGTATAGCCTCGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015655.2-1603s21c1
Sequence:CCGGTGGGCGAAGGTTTCGGGATAACTCGAGTTATCCCGAAACCTTCGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015655
ZNF337 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 337
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015655.2-608s1c1
Sequence:CCGGCCTACAGAAATAGACAAAGTACTCGAGTACTTTGTCTATTTCTGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015655.2-1257s1c1
Sequence:CCGGGCAGGCAGTGTAAGCAAAGTTCTCGAGAACTTTGCTTACACTGCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015655.2-371s1c1
Sequence:CCGGGCAGGAATATATGCAGAACATCTCGAGATGTTCTGCATATATTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015655.2-771s1c1
Sequence:CCGGGCTTTAGAGATGAGTCAGCATCTCGAGATGCTGACTCATCTCTAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015655.2-2292s1c1
Sequence:CCGGGCAATAAGTCATACTACAGTACTCGAGTACTGTAGTATGACTTATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015655.2-1016s21c1
Sequence:CCGGGGGCGAAGGTTTAACGATAAGCTCGAGCTTATCGTTAAACCTTCGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015655.2-1257s21c1
Sequence:CCGGGCAGGCAGTGTAAGCAAAGTTCTCGAGAACTTTGCTTACACTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015655.2-2461s21c1
Sequence:CCGGACTTGTTCGTGAAGATATAACCTCGAGGTTATATCTTCACGAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015655.2-1099s21c1
Sequence:CCGGTGGGCGAGGCTATACTAATAACTCGAGTTATTAGTATAGCCTCGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015655.2-1603s21c1
Sequence:CCGGTGGGCGAAGGTTTCGGGATAACTCGAGTTATCCCGAAACCTTCGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015655
ZNF337 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 337
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015655.2-608s1c1
Sequence:CCGGCCTACAGAAATAGACAAAGTACTCGAGTACTTTGTCTATTTCTGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015655.2-1257s1c1
Sequence:CCGGGCAGGCAGTGTAAGCAAAGTTCTCGAGAACTTTGCTTACACTGCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015655.2-371s1c1
Sequence:CCGGGCAGGAATATATGCAGAACATCTCGAGATGTTCTGCATATATTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015655.2-771s1c1
Sequence:CCGGGCTTTAGAGATGAGTCAGCATCTCGAGATGCTGACTCATCTCTAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015655.2-2292s1c1
Sequence:CCGGGCAATAAGTCATACTACAGTACTCGAGTACTGTAGTATGACTTATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015655.2-1016s21c1
Sequence:CCGGGGGCGAAGGTTTAACGATAAGCTCGAGCTTATCGTTAAACCTTCGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015655.2-1257s21c1
Sequence:CCGGGCAGGCAGTGTAAGCAAAGTTCTCGAGAACTTTGCTTACACTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015655.2-2461s21c1
Sequence:CCGGACTTGTTCGTGAAGATATAACCTCGAGGTTATATCTTCACGAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015655.2-1099s21c1
Sequence:CCGGTGGGCGAGGCTATACTAATAACTCGAGTTATTAGTATAGCCTCGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015655.2-1603s21c1
Sequence:CCGGTGGGCGAAGGTTTCGGGATAACTCGAGTTATCCCGAAACCTTCGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks