EMAIL THIS PAGE TO A FRIEND

ZNF33A

zinc finger protein 33A

Synonyms: KOX2 KOX31 KOX5 NF11A ZNF11 ZNF11A ZNF33 ZZAPK
UniProtKB ID: Q06730, A8K9X9, F8WAJ5, P17013, Q5VZ86
Gene ID:
dog(488949) zinc finger protein 33A
cow(282400) zinc finger protein 33A
cow(100138479) zinc finger protein 33A
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006974 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006974 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006974 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006954 Rosetta Predictions human pricing
NM_006974 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006954 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342678 predicted 772
2 SASI_Hs02_00342679 predicted 2368
3 SASI_Hs02_00342680 predicted 778
4 SASI_Hs02_00342681 predicted 2700
5 SASI_Hs02_00342682 predicted 548
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006974 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143490 predicted 774
2 SASI_Hs01_00143491 predicted 2358
3 SASI_Hs01_00143492 predicted 773
4 SASI_Hs01_00143494 predicted 2693
5 SASI_Hs01_00143493 predicted 545
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006974
ZNF33A MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 33A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006974.2-981s21c1
Sequence:CCGGCGTCAAGGGACAATCACTATGCTCGAGCATAGTGATTGTCCCTTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006974.2-547s21c1
Sequence:CCGGACCATTTAATGTGGATGTAAGCTCGAGCTTACATCCACATTAAATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006974.2-3048s21c1
Sequence:CCGGCAAACTTCCTCTAAGGATAATCTCGAGATTATCCTTAGAGGAAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006974.2-776s21c1
Sequence:CCGGAGTCATCATGAGGAGACTTTGCTCGAGCAAAGTCTCCTCATGATGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006974.1-2557s1c1
Sequence:CCGGCGGGCATAACACCTTACAGATCTCGAGATCTGTAAGGTGTTATGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006974.1-1348s1c1
Sequence:CCGGCGTGTGACTTCGCACCTTAAACTCGAGTTTAAGGTGCGAAGTCACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006974.1-1265s1c1
Sequence:CCGGGCCAGAAATCTGACCTCACTACTCGAGTAGTGAGGTCAGATTTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006974.1-2367s1c1
Sequence:CCGGCCTCCATAATGCCTCAGAGTACTCGAGTACTCTGAGGCATTATGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006974.1-417s1c1
Sequence:CCGGTCAGTGTGATTCATGTGGAATCTCGAGATTCCACATGAATCACACTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006974
ZNF33A MISSION shRNA shRNA Plasmid DNA
zinc finger protein 33A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006974.2-981s21c1
Sequence:CCGGCGTCAAGGGACAATCACTATGCTCGAGCATAGTGATTGTCCCTTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006974.2-547s21c1
Sequence:CCGGACCATTTAATGTGGATGTAAGCTCGAGCTTACATCCACATTAAATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006974.2-3048s21c1
Sequence:CCGGCAAACTTCCTCTAAGGATAATCTCGAGATTATCCTTAGAGGAAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006974.2-776s21c1
Sequence:CCGGAGTCATCATGAGGAGACTTTGCTCGAGCAAAGTCTCCTCATGATGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006974.1-2557s1c1
Sequence:CCGGCGGGCATAACACCTTACAGATCTCGAGATCTGTAAGGTGTTATGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006974.1-1348s1c1
Sequence:CCGGCGTGTGACTTCGCACCTTAAACTCGAGTTTAAGGTGCGAAGTCACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006974.1-1265s1c1
Sequence:CCGGGCCAGAAATCTGACCTCACTACTCGAGTAGTGAGGTCAGATTTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006974.1-2367s1c1
Sequence:CCGGCCTCCATAATGCCTCAGAGTACTCGAGTACTCTGAGGCATTATGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006974.1-417s1c1
Sequence:CCGGTCAGTGTGATTCATGTGGAATCTCGAGATTCCACATGAATCACACTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006974
ZNF33A MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 33A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006974.2-981s21c1
Sequence:CCGGCGTCAAGGGACAATCACTATGCTCGAGCATAGTGATTGTCCCTTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006974.2-547s21c1
Sequence:CCGGACCATTTAATGTGGATGTAAGCTCGAGCTTACATCCACATTAAATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006974.2-3048s21c1
Sequence:CCGGCAAACTTCCTCTAAGGATAATCTCGAGATTATCCTTAGAGGAAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006974.2-776s21c1
Sequence:CCGGAGTCATCATGAGGAGACTTTGCTCGAGCAAAGTCTCCTCATGATGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006974.1-2557s1c1
Sequence:CCGGCGGGCATAACACCTTACAGATCTCGAGATCTGTAAGGTGTTATGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006974.1-1348s1c1
Sequence:CCGGCGTGTGACTTCGCACCTTAAACTCGAGTTTAAGGTGCGAAGTCACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006974.1-1265s1c1
Sequence:CCGGGCCAGAAATCTGACCTCACTACTCGAGTAGTGAGGTCAGATTTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006974.1-2367s1c1
Sequence:CCGGCCTCCATAATGCCTCAGAGTACTCGAGTACTCTGAGGCATTATGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006974.1-417s1c1
Sequence:CCGGTCAGTGTGATTCATGTGGAATCTCGAGATTCCACATGAATCACACTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks