EMAIL THIS PAGE TO A FRIEND

ZNF33B

zinc finger protein 33B

Synonyms: KOX2 KOX31 ZNF11B
UniProtKB ID: Q06732, Q06731, Q32MA2, Q86XY8, Q8NDW3
Gene ID:
cow(520684) zinc finger protein 33B
sheep(100527962) zinc finger protein 33B
domestic guinea pig(100732547) zinc finger protein 33B
naked mole-rat(101713368) zinc finger protein 33B
90 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302665 ANTI-ZN33B (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006955 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006955 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006955 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006955 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006955 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146556 predicted 920
2 SASI_Hs01_00146557 predicted 486
3 SASI_Hs01_00146558 predicted 2137
4 SASI_Hs01_00146559 predicted 1458
5 SASI_Hs01_00146560 predicted 2309
6 SASI_Hs01_00146561 predicted 2303
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006955
VALIDATED
ZNF33B MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 33B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006955.1-4948s1c1
Sequence:CCGGGCCTTGTTCAACATTTGATATCTCGAGATATCAAATGTTGAACAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006955.1-488s1c1
Sequence:CCGGCCATTTAACATGGACGTAAGTCTCGAGACTTACGTCCATGTTAAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006955.1-1311s1c1
Sequence:CCGGCCCTCACATTACACCAGAGAACTCGAGTTCTCTGGTGTAATGTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006955.1-2308s1c1
Sequence:CCGGCCGTAAATCAGACCTTGCTAACTCGAGTTAGCAAGGTCTGATTTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006955.1-1815s1c1
Sequence:CCGGCCCTCTCTCAACATTATAGAACTCGAGTTCTATAATGTTGAGAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006955
VALIDATED
ZNF33B MISSION shRNA shRNA Plasmid DNA
zinc finger protein 33B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006955.1-4948s1c1
Sequence:CCGGGCCTTGTTCAACATTTGATATCTCGAGATATCAAATGTTGAACAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006955.1-488s1c1
Sequence:CCGGCCATTTAACATGGACGTAAGTCTCGAGACTTACGTCCATGTTAAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006955.1-1311s1c1
Sequence:CCGGCCCTCACATTACACCAGAGAACTCGAGTTCTCTGGTGTAATGTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006955.1-2308s1c1
Sequence:CCGGCCGTAAATCAGACCTTGCTAACTCGAGTTAGCAAGGTCTGATTTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006955.1-1815s1c1
Sequence:CCGGCCCTCTCTCAACATTATAGAACTCGAGTTCTATAATGTTGAGAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006955
VALIDATED
ZNF33B MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 33B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006955.1-4948s1c1
Sequence:CCGGGCCTTGTTCAACATTTGATATCTCGAGATATCAAATGTTGAACAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006955.1-488s1c1
Sequence:CCGGCCATTTAACATGGACGTAAGTCTCGAGACTTACGTCCATGTTAAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006955.1-1311s1c1
Sequence:CCGGCCCTCACATTACACCAGAGAACTCGAGTTCTCTGGTGTAATGTGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006955.1-2308s1c1
Sequence:CCGGCCGTAAATCAGACCTTGCTAACTCGAGTTAGCAAGGTCTGATTTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006955.1-1815s1c1
Sequence:CCGGCCCTCTCTCAACATTATAGAACTCGAGTTCTATAATGTTGAGAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks