EMAIL THIS PAGE TO A FRIEND

ZNF341

zinc finger protein 341

UniProtKB ID: Q9BYN7, A2RUF4, B2RXE5, B7ZM09, Q5JXM8, Q96ST5
Gene ID:
cow(523204) zinc finger protein 341
sheep(101117781) zinc finger protein 341
domestic guinea pig(100734523) zinc finger protein 341
naked mole-rat(101716368) zinc finger protein 341
chicken(419152) zinc finger protein 341
dog(485841) zinc finger protein 341
domestic cat(101090181) zinc finger protein 341
23 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032819 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032819 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032819 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU134451 MISSION® esiRNA esiRNA human ZNF341 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032819 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032819 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133589 predicted 907
2 SASI_Hs01_00133590 predicted 974
3 SASI_Hs01_00133591 predicted 1978
4 SASI_Hs01_00133592 predicted 1077
5 SASI_Hs01_00133593 predicted 1612
6 SASI_Hs01_00133594 predicted 1909
7 SASI_Hs01_00133595 predicted 1379
8 SASI_Hs01_00133596 predicted 1614
9 SASI_Hs01_00133597 predicted 887
10 SASI_Hs01_00133598 predicted 1147
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032819
ZNF341 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 341
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000233220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032819.3-775s21c1
Sequence:CCGGGTGTGGAGCCTCCAGTATATCCTCGAGGATATACTGGAGGCTCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032819.3-916s21c1
Sequence:CCGGTGAAGACCCGACGAGCTAAAGCTCGAGCTTTAGCTCGTCGGGTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032819.3-1612s21c1
Sequence:CCGGCCGTCTACAAGTGTGTCAAATCTCGAGATTTGACACACTTGTAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032819.3-2663s21c1
Sequence:CCGGCATCGAGCCATTGGCAGAAATCTCGAGATTTCTGCCAATGGCTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032819.3-1449s21c1
Sequence:CCGGTTCCCAAAGCTCGACACATTTCTCGAGAAATGTGTCGAGCTTTGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032819.3-1598s1c1
Sequence:CCGGCAAGAAGGACAATGCCGTCTACTCGAGTAGACGGCATTGTCCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032819.3-816s1c1
Sequence:CCGGCCTGGCAAACAGGGATTCAAACTCGAGTTTGAATCCCTGTTTGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150341    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032819.3-2967s1c1
Sequence:CCGGCCATAAACTCTTCGGAGTTTACTCGAGTAAACTCCGAAGAGTTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152506    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032819.3-2966s1c1
Sequence:CCGGGCCATAAACTCTTCGGAGTTTCTCGAGAAACTCCGAAGAGTTTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032819.3-184s1c1
Sequence:CCGGGCGGGAAGTGTAAGAAGCAATCTCGAGATTGCTTCTTACACTTCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032819
ZNF341 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 341
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000233220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032819.3-775s21c1
Sequence:CCGGGTGTGGAGCCTCCAGTATATCCTCGAGGATATACTGGAGGCTCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032819.3-916s21c1
Sequence:CCGGTGAAGACCCGACGAGCTAAAGCTCGAGCTTTAGCTCGTCGGGTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032819.3-1612s21c1
Sequence:CCGGCCGTCTACAAGTGTGTCAAATCTCGAGATTTGACACACTTGTAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032819.3-2663s21c1
Sequence:CCGGCATCGAGCCATTGGCAGAAATCTCGAGATTTCTGCCAATGGCTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032819.3-1449s21c1
Sequence:CCGGTTCCCAAAGCTCGACACATTTCTCGAGAAATGTGTCGAGCTTTGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032819.3-1598s1c1
Sequence:CCGGCAAGAAGGACAATGCCGTCTACTCGAGTAGACGGCATTGTCCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032819.3-816s1c1
Sequence:CCGGCCTGGCAAACAGGGATTCAAACTCGAGTTTGAATCCCTGTTTGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150341    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032819.3-2967s1c1
Sequence:CCGGCCATAAACTCTTCGGAGTTTACTCGAGTAAACTCCGAAGAGTTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152506    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032819.3-2966s1c1
Sequence:CCGGGCCATAAACTCTTCGGAGTTTCTCGAGAAACTCCGAAGAGTTTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032819.3-184s1c1
Sequence:CCGGGCGGGAAGTGTAAGAAGCAATCTCGAGATTGCTTCTTACACTTCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032819
ZNF341 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 341
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000233220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032819.3-775s21c1
Sequence:CCGGGTGTGGAGCCTCCAGTATATCCTCGAGGATATACTGGAGGCTCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032819.3-916s21c1
Sequence:CCGGTGAAGACCCGACGAGCTAAAGCTCGAGCTTTAGCTCGTCGGGTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032819.3-1612s21c1
Sequence:CCGGCCGTCTACAAGTGTGTCAAATCTCGAGATTTGACACACTTGTAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233224    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032819.3-2663s21c1
Sequence:CCGGCATCGAGCCATTGGCAGAAATCTCGAGATTTCTGCCAATGGCTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032819.3-1449s21c1
Sequence:CCGGTTCCCAAAGCTCGACACATTTCTCGAGAAATGTGTCGAGCTTTGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032819.3-1598s1c1
Sequence:CCGGCAAGAAGGACAATGCCGTCTACTCGAGTAGACGGCATTGTCCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032819.3-816s1c1
Sequence:CCGGCCTGGCAAACAGGGATTCAAACTCGAGTTTGAATCCCTGTTTGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150341    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032819.3-2967s1c1
Sequence:CCGGCCATAAACTCTTCGGAGTTTACTCGAGTAAACTCCGAAGAGTTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152506    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032819.3-2966s1c1
Sequence:CCGGGCCATAAACTCTTCGGAGTTTCTCGAGAAACTCCGAAGAGTTTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032819.3-184s1c1
Sequence:CCGGGCGGGAAGTGTAAGAAGCAATCTCGAGATTGCTTCTTACACTTCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks