EMAIL THIS PAGE TO A FRIEND

ZNF343

zinc finger protein 343

Synonyms: dJ734P14.5
Species: Human ZNF343(79175), naked mole-rat Znf343(101722624)
Gene ID:
naked mole-rat(101722624) zinc finger protein 343
23 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024325 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024325 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024325 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU134151 MISSION® esiRNA esiRNA human ZNF343 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024325 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024325 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165736 predicted 1200
2 SASI_Hs01_00165737 predicted 2029
3 SASI_Hs01_00165738 predicted 1960
4 SASI_Hs01_00165741 predicted 2235
5 SASI_Hs02_00356672 predicted 856
6 SASI_Hs01_00165743 predicted 1224
7 SASI_Hs01_00165744 predicted 647
8 SASI_Hs01_00165745 predicted 1172
9 SASI_Hs02_00356673 predicted 1772
10 SASI_Hs02_00356674 predicted 2205
11 SASI_Hs01_00165739 predicted 1750
12 SASI_Hs01_00165740 predicted 2378
13 SASI_Hs01_00165742 predicted 807
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024325
ZNF343 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 343
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024325.4-654s1c1
Sequence:CCGGGCCCAAATAGTGGTACCAGTTCTCGAGAACTGGTACCACTATTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024325.4-1231s1c1
Sequence:CCGGCGGACCATAACCTGGAATCAACTCGAGTTGATTCCAGGTTATGGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024325.4-1160s1c1
Sequence:CCGGGCAGCTAGACAAAGGCTTGAACTCGAGTTCAAGCCTTTGTCTAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024325.4-571s1c1
Sequence:CCGGCTATGAAGAAATTGACCCAAACTCGAGTTTGGGTCAATTTCTTCATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024325.4-654s21c1
Sequence:CCGGGCCCAAATAGTGGTACCAGTTCTCGAGAACTGGTACCACTATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024325.4-571s21c1
Sequence:CCGGCTATGAAGAAATTGACCCAAACTCGAGTTTGGGTCAATTTCTTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024325.4-1900s21c1
Sequence:CCGGGCCGAGGCTTTAGTCGGAAATCTCGAGATTTCCGACTAAAGCCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024325.4-1160s21c1
Sequence:CCGGGCAGCTAGACAAAGGCTTGAACTCGAGTTCAAGCCTTTGTCTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024325
ZNF343 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 343
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024325.4-654s1c1
Sequence:CCGGGCCCAAATAGTGGTACCAGTTCTCGAGAACTGGTACCACTATTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024325.4-1231s1c1
Sequence:CCGGCGGACCATAACCTGGAATCAACTCGAGTTGATTCCAGGTTATGGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024325.4-1160s1c1
Sequence:CCGGGCAGCTAGACAAAGGCTTGAACTCGAGTTCAAGCCTTTGTCTAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024325.4-571s1c1
Sequence:CCGGCTATGAAGAAATTGACCCAAACTCGAGTTTGGGTCAATTTCTTCATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024325.4-654s21c1
Sequence:CCGGGCCCAAATAGTGGTACCAGTTCTCGAGAACTGGTACCACTATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024325.4-571s21c1
Sequence:CCGGCTATGAAGAAATTGACCCAAACTCGAGTTTGGGTCAATTTCTTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024325.4-1900s21c1
Sequence:CCGGGCCGAGGCTTTAGTCGGAAATCTCGAGATTTCCGACTAAAGCCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024325.4-1160s21c1
Sequence:CCGGGCAGCTAGACAAAGGCTTGAACTCGAGTTCAAGCCTTTGTCTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024325
ZNF343 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 343
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024325.4-654s1c1
Sequence:CCGGGCCCAAATAGTGGTACCAGTTCTCGAGAACTGGTACCACTATTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024325.4-1231s1c1
Sequence:CCGGCGGACCATAACCTGGAATCAACTCGAGTTGATTCCAGGTTATGGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024325.4-1160s1c1
Sequence:CCGGGCAGCTAGACAAAGGCTTGAACTCGAGTTCAAGCCTTTGTCTAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024325.4-571s1c1
Sequence:CCGGCTATGAAGAAATTGACCCAAACTCGAGTTTGGGTCAATTTCTTCATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024325.4-654s21c1
Sequence:CCGGGCCCAAATAGTGGTACCAGTTCTCGAGAACTGGTACCACTATTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024325.4-571s21c1
Sequence:CCGGCTATGAAGAAATTGACCCAAACTCGAGTTTGGGTCAATTTCTTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024325.4-1900s21c1
Sequence:CCGGGCCGAGGCTTTAGTCGGAAATCTCGAGATTTCCGACTAAAGCCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024325.4-1160s21c1
Sequence:CCGGGCAGCTAGACAAAGGCTTGAACTCGAGTTCAAGCCTTTGTCTAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks