EMAIL THIS PAGE TO A FRIEND

ZNF345

zinc finger protein 345

Synonyms: HZF10
UniProtKB ID: Q14585
Gene ID:
cow(518207) zinc finger protein 345
sheep(101108415) zinc finger protein 345
dog(484547) zinc finger protein 345
dog(100686823) zinc finger protein 345
24 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003419 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003419 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003419 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU025351 MISSION® esiRNA esiRNA human ZNF345 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003419 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003419 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211106 predicted 511
2 SASI_Hs01_00211107 predicted 938
3 SASI_Hs01_00211108 predicted 1611
4 SASI_Hs01_00211109 predicted 1775
5 SASI_Hs01_00211111 predicted 1730
6 SASI_Hs01_00211112 predicted 508
7 SASI_Hs01_00211113 predicted 1027
8 SASI_Hs01_00211114 predicted 1766
9 SASI_Hs01_00211115 predicted 1030
10 SASI_Hs02_00335632 predicted 1084
11 SASI_Hs01_00211110 predicted 480
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003419
ZNF345 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 345
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003419.3-1015s21c1
Sequence:CCGGAGTGGTTCAAACCTTACTCAACTCGAGTTGAGTAAGGTTTGAACCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435295    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003419.3-2316s21c1
Sequence:CCGGGACTATTTGATGGTAAGTTACCTCGAGGTAACTTACCATCAAATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003419.3-464s21c1
Sequence:CCGGGATCTCAGGAAGGACATTTCACTCGAGTGAAATGTCCTTCCTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003419.3-1433s21c1
Sequence:CCGGGTAGTGGTTCAGACCTTACTCCTCGAGGAGTAAGGTCTGAACCACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003419.3-1531s21c1
Sequence:CCGGCTTATCCAACACCAGCTAATCCTCGAGGATTAGCTGGTGTTGGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003419.3-1749s21c1
Sequence:CCGGGAACTGTGGGAAGGCTTATGGCTCGAGCCATAAGCCTTCCCACAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003419.3-1599s21c1
Sequence:CCGGTAGTAGTGGTTCAGCTCTTAACTCGAGTTAAGAGCTGAACCACTACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003419.3-508s21c1
Sequence:CCGGGACATGCCCACTTTCAGTATCCTCGAGGATACTGAAAGTGGGCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430069    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003419.3-1925s21c1
Sequence:CCGGAGGTACAAATGCCTTACTTATCTCGAGATAAGTAAGGCATTTGTACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003419.2-1775s1c1
Sequence:CCGGGATTCAGAGTTTCAGCAACATCTCGAGATGTTGCTGAAACTCTGAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003419
ZNF345 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 345
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003419.3-1015s21c1
Sequence:CCGGAGTGGTTCAAACCTTACTCAACTCGAGTTGAGTAAGGTTTGAACCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435295    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003419.3-2316s21c1
Sequence:CCGGGACTATTTGATGGTAAGTTACCTCGAGGTAACTTACCATCAAATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003419.3-464s21c1
Sequence:CCGGGATCTCAGGAAGGACATTTCACTCGAGTGAAATGTCCTTCCTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003419.3-1433s21c1
Sequence:CCGGGTAGTGGTTCAGACCTTACTCCTCGAGGAGTAAGGTCTGAACCACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003419.3-1531s21c1
Sequence:CCGGCTTATCCAACACCAGCTAATCCTCGAGGATTAGCTGGTGTTGGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003419.3-1749s21c1
Sequence:CCGGGAACTGTGGGAAGGCTTATGGCTCGAGCCATAAGCCTTCCCACAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003419.3-1599s21c1
Sequence:CCGGTAGTAGTGGTTCAGCTCTTAACTCGAGTTAAGAGCTGAACCACTACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003419.3-508s21c1
Sequence:CCGGGACATGCCCACTTTCAGTATCCTCGAGGATACTGAAAGTGGGCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430069    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003419.3-1925s21c1
Sequence:CCGGAGGTACAAATGCCTTACTTATCTCGAGATAAGTAAGGCATTTGTACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003419.2-1775s1c1
Sequence:CCGGGATTCAGAGTTTCAGCAACATCTCGAGATGTTGCTGAAACTCTGAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003419
ZNF345 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 345
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003419.3-1015s21c1
Sequence:CCGGAGTGGTTCAAACCTTACTCAACTCGAGTTGAGTAAGGTTTGAACCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435295    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003419.3-2316s21c1
Sequence:CCGGGACTATTTGATGGTAAGTTACCTCGAGGTAACTTACCATCAAATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003419.3-464s21c1
Sequence:CCGGGATCTCAGGAAGGACATTTCACTCGAGTGAAATGTCCTTCCTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003419.3-1433s21c1
Sequence:CCGGGTAGTGGTTCAGACCTTACTCCTCGAGGAGTAAGGTCTGAACCACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003419.3-1531s21c1
Sequence:CCGGCTTATCCAACACCAGCTAATCCTCGAGGATTAGCTGGTGTTGGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003419.3-1749s21c1
Sequence:CCGGGAACTGTGGGAAGGCTTATGGCTCGAGCCATAAGCCTTCCCACAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003419.3-1599s21c1
Sequence:CCGGTAGTAGTGGTTCAGCTCTTAACTCGAGTTAAGAGCTGAACCACTACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003419.3-508s21c1
Sequence:CCGGGACATGCCCACTTTCAGTATCCTCGAGGATACTGAAAGTGGGCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430069    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003419.3-1925s21c1
Sequence:CCGGAGGTACAAATGCCTTACTTATCTCGAGATAAGTAAGGCATTTGTACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003419.2-1775s1c1
Sequence:CCGGGATTCAGAGTTTCAGCAACATCTCGAGATGTTGCTGAAACTCTGAATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks