EMAIL THIS PAGE TO A FRIEND

ZNF346

zinc finger protein 346

Synonyms: JAZ Zfp346
UniProtKB ID: Q9UL40, Q68CV9, Q6ZMW1
Gene ID:
Human(23567) Summary: The protein encoded by this gene is a nucleolar, zinc finger protein that preferentially binds to double-stranded (ds) RNA or RNA/DNA hybrids, rather than DNA alone. Mutational studies indicate that the zinc finger domains are not only essential for dsRNA binding, but are also required for its nucleolar localization. The encoded protein may be involved in cell growth and survival. [provided by RefSeq, Jul 2008]
Zebrafish(560756) zinc finger protein 346
chicken(416144) zinc finger protein 346
domestic cat(101101288) zinc finger protein 346
dog(612983) zinc finger protein 346
cow(533548) zinc finger protein 346
sheep(101120238) zinc finger protein 346
naked mole-rat(101702798) zinc finger protein 346
domestic guinea pig(100733241) zinc finger protein 346
Gene Class: Apoptosis
176 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012279 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012279 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012279 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU146251 MISSION® esiRNA esiRNA human ZNF346 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012279 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012279 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121026 predicted 540
2 SASI_Hs01_00121027 predicted 513
3 SASI_Hs01_00121028 predicted 942
4 SASI_Hs01_00121029 predicted 776
5 SASI_Hs01_00121031 predicted 385
6 SASI_Hs01_00121032 predicted 340
7 SASI_Hs01_00121033 predicted 804
8 SASI_Hs01_00121034 predicted 681
9 SASI_Hs01_00121035 predicted 764
10 SASI_Hs02_00344011 predicted 355
11 SASI_Hs01_00121030 predicted 631
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012279
ZNF346 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 346
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000147001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012279.2-566s1c1
Sequence:CCGGCACCAGAATAGAGAGATGATACTCGAGTATCATCTCTCTATTCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012279.2-688s1c1
Sequence:CCGGGCTCAAACTAATGGCACGCTACTCGAGTAGCGTGCCATTAGTTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179045    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012279.2-232s1c1
Sequence:CCGGCCAGAAGAACCAATGTCTCTTCTCGAGAAGAGACATTGGTTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012279.2-273s21c1
Sequence:CCGGTTTGCTGCGCCTTGCTTATTTCTCGAGAAATAAGCAAGGCGCAGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219820    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012279.2-1069s1c1
Sequence:CCGGCTCATTGGTCCGGGCTAATTCCTCGAGGAATTAGCCCGGACCAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012279.2-605s21c1
Sequence:CCGGAGCCTCTGCCATGCAACTTTCCTCGAGGAAAGTTGCATGGCAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012279.2-299s21c1
Sequence:CCGGTCCCAGAAGCTGGCACATTACCTCGAGGTAATGTGCCAGCTTCTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012279.2-511s21c1
Sequence:CCGGGACCCACGCAAAGAACTTAAACTCGAGTTTAAGTTCTTTGCGTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012279.2-364s1c1
Sequence:CCGGCCATGGAATGGAGACATTAAACTCGAGTTTAATGTCTCCATTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012279.2-1389s21c1
Sequence:CCGGATGGGAGCTTGGAGCTAATACCTCGAGGTATTAGCTCCAAGCTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012279
ZNF346 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 346
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000147001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012279.2-566s1c1
Sequence:CCGGCACCAGAATAGAGAGATGATACTCGAGTATCATCTCTCTATTCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012279.2-688s1c1
Sequence:CCGGGCTCAAACTAATGGCACGCTACTCGAGTAGCGTGCCATTAGTTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179045    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012279.2-232s1c1
Sequence:CCGGCCAGAAGAACCAATGTCTCTTCTCGAGAAGAGACATTGGTTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012279.2-273s21c1
Sequence:CCGGTTTGCTGCGCCTTGCTTATTTCTCGAGAAATAAGCAAGGCGCAGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219820    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012279.2-1069s1c1
Sequence:CCGGCTCATTGGTCCGGGCTAATTCCTCGAGGAATTAGCCCGGACCAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012279.2-605s21c1
Sequence:CCGGAGCCTCTGCCATGCAACTTTCCTCGAGGAAAGTTGCATGGCAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012279.2-299s21c1
Sequence:CCGGTCCCAGAAGCTGGCACATTACCTCGAGGTAATGTGCCAGCTTCTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012279.2-511s21c1
Sequence:CCGGGACCCACGCAAAGAACTTAAACTCGAGTTTAAGTTCTTTGCGTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012279.2-364s1c1
Sequence:CCGGCCATGGAATGGAGACATTAAACTCGAGTTTAATGTCTCCATTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012279.2-1389s21c1
Sequence:CCGGATGGGAGCTTGGAGCTAATACCTCGAGGTATTAGCTCCAAGCTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012279
ZNF346 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 346
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000147001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012279.2-566s1c1
Sequence:CCGGCACCAGAATAGAGAGATGATACTCGAGTATCATCTCTCTATTCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012279.2-688s1c1
Sequence:CCGGGCTCAAACTAATGGCACGCTACTCGAGTAGCGTGCCATTAGTTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179045    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012279.2-232s1c1
Sequence:CCGGCCAGAAGAACCAATGTCTCTTCTCGAGAAGAGACATTGGTTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012279.2-273s21c1
Sequence:CCGGTTTGCTGCGCCTTGCTTATTTCTCGAGAAATAAGCAAGGCGCAGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219820    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012279.2-1069s1c1
Sequence:CCGGCTCATTGGTCCGGGCTAATTCCTCGAGGAATTAGCCCGGACCAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012279.2-605s21c1
Sequence:CCGGAGCCTCTGCCATGCAACTTTCCTCGAGGAAAGTTGCATGGCAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012279.2-299s21c1
Sequence:CCGGTCCCAGAAGCTGGCACATTACCTCGAGGTAATGTGCCAGCTTCTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012279.2-511s21c1
Sequence:CCGGGACCCACGCAAAGAACTTAAACTCGAGTTTAAGTTCTTTGCGTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012279.2-364s1c1
Sequence:CCGGCCATGGAATGGAGACATTAAACTCGAGTTTAATGTCTCCATTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012279.2-1389s21c1
Sequence:CCGGATGGGAGCTTGGAGCTAATACCTCGAGGTATTAGCTCCAAGCTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks