EMAIL THIS PAGE TO A FRIEND

ZNF347

zinc finger protein 347

Synonyms: ZNF1111
UniProtKB ID: Q96SE7, B3KU77, B9EG59, G5E9N4, Q8TCN1
Gene ID:
Domestic Rabbit(100352875) zinc finger protein 347
cow(100300607) zinc finger protein 347
dog(100685304) zinc finger protein 347
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA023448 Anti-ZNF347 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032584 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032584 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032584 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032584 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032584 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213658 predicted 401
2 SASI_Hs01_00213659 predicted 846
3 SASI_Hs02_00360116 predicted 368
4 SASI_Hs01_00213660 predicted 587
5 SASI_Hs01_00213661 predicted 1481
6 SASI_Hs01_00213662 predicted 1202
7 SASI_Hs01_00213663 predicted 1302
8 SASI_Hs01_00213664 predicted 951
9 SASI_Hs01_00213665 predicted 1028
10 SASI_Hs01_00213666 predicted 1902
11 SASI_Hs01_00213667 predicted 234
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032584
ZNF347 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 347
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435097    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032584.1-3039s21c1
Sequence:CCGGAGACATCCAAGAGTCCATAATCTCGAGATTATGGACTCTTGGATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032584.1-1457s21c1
Sequence:CCGGGCAAGGTCTTTAGGCGTAATTCTCGAGAATTACGCCTAAAGACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032584.1-2529s21c1
Sequence:CCGGTAACGTGTGGAAAGTTCTAAACTCGAGTTTAGAACTTTCCACACGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032584.1-1397s1c1
Sequence:CCGGGCCTAGCTATTCATCTGGTAACTCGAGTTACCAGATGAATAGCTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032584.1-2085s1c1
Sequence:CCGGGAGAGTTCATACTGGAGGTAACTCGAGTTACCTCCAGTATGAACTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032584.1-282s1c1
Sequence:CCGGCCAAGTACAAATAGCAGGAAACTCGAGTTTCCTGCTATTTGTACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032584.1-228s1c1
Sequence:CCGGCCTCAGTATTATCTCTATGTTCTCGAGAACATAGAGATAATACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032584.1-1146s1c1
Sequence:CCGGCCTTGTAAGACATCGAGGAATCTCGAGATTCCTCGATGTCTTACAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032584
ZNF347 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 347
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435097    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032584.1-3039s21c1
Sequence:CCGGAGACATCCAAGAGTCCATAATCTCGAGATTATGGACTCTTGGATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032584.1-1457s21c1
Sequence:CCGGGCAAGGTCTTTAGGCGTAATTCTCGAGAATTACGCCTAAAGACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032584.1-2529s21c1
Sequence:CCGGTAACGTGTGGAAAGTTCTAAACTCGAGTTTAGAACTTTCCACACGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032584.1-1397s1c1
Sequence:CCGGGCCTAGCTATTCATCTGGTAACTCGAGTTACCAGATGAATAGCTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032584.1-2085s1c1
Sequence:CCGGGAGAGTTCATACTGGAGGTAACTCGAGTTACCTCCAGTATGAACTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032584.1-282s1c1
Sequence:CCGGCCAAGTACAAATAGCAGGAAACTCGAGTTTCCTGCTATTTGTACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032584.1-228s1c1
Sequence:CCGGCCTCAGTATTATCTCTATGTTCTCGAGAACATAGAGATAATACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032584.1-1146s1c1
Sequence:CCGGCCTTGTAAGACATCGAGGAATCTCGAGATTCCTCGATGTCTTACAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032584
ZNF347 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 347
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435097    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032584.1-3039s21c1
Sequence:CCGGAGACATCCAAGAGTCCATAATCTCGAGATTATGGACTCTTGGATGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032584.1-1457s21c1
Sequence:CCGGGCAAGGTCTTTAGGCGTAATTCTCGAGAATTACGCCTAAAGACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032584.1-2529s21c1
Sequence:CCGGTAACGTGTGGAAAGTTCTAAACTCGAGTTTAGAACTTTCCACACGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032584.1-1397s1c1
Sequence:CCGGGCCTAGCTATTCATCTGGTAACTCGAGTTACCAGATGAATAGCTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032584.1-2085s1c1
Sequence:CCGGGAGAGTTCATACTGGAGGTAACTCGAGTTACCTCCAGTATGAACTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032584.1-282s1c1
Sequence:CCGGCCAAGTACAAATAGCAGGAAACTCGAGTTTCCTGCTATTTGTACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032584.1-228s1c1
Sequence:CCGGCCTCAGTATTATCTCTATGTTCTCGAGAACATAGAGATAATACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032584.1-1146s1c1
Sequence:CCGGCCTTGTAAGACATCGAGGAATCTCGAGATTCCTCGATGTCTTACAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks