EMAIL THIS PAGE TO A FRIEND

ZNF34

zinc finger protein 34

Synonyms: KOX32
UniProtKB ID: Q8IZ26, D3DWN1, Q9BSZ0
Gene ID:
domestic cat(101098688) zinc finger protein 34
dog(482107) zinc finger protein 34
naked mole-rat(101704030) zinc finger protein 34
domestic guinea pig(100714362) zinc finger protein 34
cow(615905) zinc finger protein 34
sheep(101114875) zinc finger protein 34
23 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030580 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030580 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030580 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU130741 MISSION® esiRNA esiRNA human ZNF34 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030580 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030580 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213678 predicted 1210
2 SASI_Hs01_00213679 predicted 1291
3 SASI_Hs01_00213680 predicted 1308
4 SASI_Hs01_00213681 predicted 972
5 SASI_Hs01_00213682 predicted 215
6 SASI_Hs01_00213683 predicted 1306
7 SASI_Hs01_00213684 predicted 1225
8 SASI_Hs02_00358151 predicted 1389
9 SASI_Hs01_00213686 predicted 472
10 SASI_Hs01_00213687 predicted 1134
11 SASI_Hs01_00213685 predicted 636
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030580
ZNF34 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 34
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107320    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030580.2-1920s1c1
Sequence:CCGGCCAGCTGAGCACTTCCTGCATCTCGAGATGCAGGAAGTGCTCAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030580.2-563s1c1
Sequence:CCGGCAGAACTGAGTACAAGGAGTTCTCGAGAACTCCTTGTACTCAGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030580.2-1084s1c1
Sequence:CCGGGCGAGTTCATCAATCACCGAACTCGAGTTCGGTGATTGATGAACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030580.2-1244s1c1
Sequence:CCGGCGCCTACTCTTCCCTGATTTACTCGAGTAAATCAGGGAAGAGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030580.2-905s1c1
Sequence:CCGGCAGTGCAAACTTAGTTGTTAACTCGAGTTAACAACTAAGTTTGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030580.3-1302s21c1
Sequence:CCGGTACACAAAGTTCTAACCTTATCTCGAGATAAGGTTAGAACTTTGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030580.3-680s21c1
Sequence:CCGGGACCTCACAAATGTGATATATCTCGAGATATATCACATTTGTGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030580.3-723s21c1
Sequence:CCGGATCATATCTCAACAACCATAACTCGAGTTATGGTTGTTGAGATATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030580.3-1139s21c1
Sequence:CCGGCCTACTCTTCCCTGATTTATCCTCGAGGATAAATCAGGGAAGAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030580
ZNF34 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 34
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107320    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030580.2-1920s1c1
Sequence:CCGGCCAGCTGAGCACTTCCTGCATCTCGAGATGCAGGAAGTGCTCAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030580.2-563s1c1
Sequence:CCGGCAGAACTGAGTACAAGGAGTTCTCGAGAACTCCTTGTACTCAGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030580.2-1084s1c1
Sequence:CCGGGCGAGTTCATCAATCACCGAACTCGAGTTCGGTGATTGATGAACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030580.2-1244s1c1
Sequence:CCGGCGCCTACTCTTCCCTGATTTACTCGAGTAAATCAGGGAAGAGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030580.2-905s1c1
Sequence:CCGGCAGTGCAAACTTAGTTGTTAACTCGAGTTAACAACTAAGTTTGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030580.3-1302s21c1
Sequence:CCGGTACACAAAGTTCTAACCTTATCTCGAGATAAGGTTAGAACTTTGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030580.3-680s21c1
Sequence:CCGGGACCTCACAAATGTGATATATCTCGAGATATATCACATTTGTGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030580.3-723s21c1
Sequence:CCGGATCATATCTCAACAACCATAACTCGAGTTATGGTTGTTGAGATATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030580.3-1139s21c1
Sequence:CCGGCCTACTCTTCCCTGATTTATCCTCGAGGATAAATCAGGGAAGAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030580
ZNF34 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 34
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107320    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030580.2-1920s1c1
Sequence:CCGGCCAGCTGAGCACTTCCTGCATCTCGAGATGCAGGAAGTGCTCAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030580.2-563s1c1
Sequence:CCGGCAGAACTGAGTACAAGGAGTTCTCGAGAACTCCTTGTACTCAGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030580.2-1084s1c1
Sequence:CCGGGCGAGTTCATCAATCACCGAACTCGAGTTCGGTGATTGATGAACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030580.2-1244s1c1
Sequence:CCGGCGCCTACTCTTCCCTGATTTACTCGAGTAAATCAGGGAAGAGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030580.2-905s1c1
Sequence:CCGGCAGTGCAAACTTAGTTGTTAACTCGAGTTAACAACTAAGTTTGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030580.3-1302s21c1
Sequence:CCGGTACACAAAGTTCTAACCTTATCTCGAGATAAGGTTAGAACTTTGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030580.3-680s21c1
Sequence:CCGGGACCTCACAAATGTGATATATCTCGAGATATATCACATTTGTGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030580.3-723s21c1
Sequence:CCGGATCATATCTCAACAACCATAACTCGAGTTATGGTTGTTGAGATATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030580.3-1139s21c1
Sequence:CCGGCCTACTCTTCCCTGATTTATCCTCGAGGATAAATCAGGGAAGAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks