EMAIL THIS PAGE TO A FRIEND

ZNF350

zinc finger protein 350

Synonyms: ZBRK1 ZFQR
UniProtKB ID: Q9GZX5, Q96G73, Q9HAQ4
Gene ID:
naked mole-rat(101704190) zinc finger protein 350
Domestic Rabbit(100353822) zinc finger protein 350
cow(515334) zinc finger protein 350
domestic cat(101084755) zinc finger protein 350
23 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021632 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021632 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021632 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU023651 MISSION® esiRNA esiRNA human ZNF350 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021632 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021632 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076289 predicted 883
2 SASI_Hs01_00076290 predicted 1042
3 SASI_Hs01_00076291 predicted 778
4 SASI_Hs01_00076292 predicted 1781
5 SASI_Hs01_00076293 predicted 931
6 SASI_Hs01_00076294 predicted 1290
7 SASI_Hs01_00076295 predicted 959
8 SASI_Hs02_00354983 predicted 889
9 SASI_Hs01_00076296 predicted 1551
10 SASI_Hs01_00076297 predicted 1461
11 SASI_Hs01_00076298 predicted 421
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021632
ZNF350 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 350
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021632.3-889s21c1
Sequence:CCGGCTAACTGATCACCAGGTAATGCTCGAGCATTACCTGGTGATCAGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424359    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021632.3-2010s21c1
Sequence:CCGGTTGCTCGACTGTGTCAATTAACTCGAGTTAATTGACACAGTCGAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021632.3-2152s21c1
Sequence:CCGGTTGGTGGGAAAGGGCTAATACCTCGAGGTATTAGCCCTTTCCCACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108060    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021632.3-1931s1c1
Sequence:CCGGCCTGATAAACTCATCCTATTACTCGAGTAATAGGATGAGTTTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021632.3-727s1c1
Sequence:CCGGGCTAACCATGAACGACTTCATCTCGAGATGAAGTCGTTCATGGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021632.3-1462s1c1
Sequence:CCGGGCGTATATGTCGTGTCTGGTTCTCGAGAACCAGACACGACATATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021632.3-661s1c1
Sequence:CCGGCAGAGCAAAGGCTATGAAATACTCGAGTATTTCATAGCCTTTGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021632.3-1666s1c1
Sequence:CCGGGCAAACAGGAACGTAGTCCTTCTCGAGAAGGACTACGTTCCTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021632
ZNF350 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 350
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021632.3-889s21c1
Sequence:CCGGCTAACTGATCACCAGGTAATGCTCGAGCATTACCTGGTGATCAGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424359    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021632.3-2010s21c1
Sequence:CCGGTTGCTCGACTGTGTCAATTAACTCGAGTTAATTGACACAGTCGAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021632.3-2152s21c1
Sequence:CCGGTTGGTGGGAAAGGGCTAATACCTCGAGGTATTAGCCCTTTCCCACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108060    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021632.3-1931s1c1
Sequence:CCGGCCTGATAAACTCATCCTATTACTCGAGTAATAGGATGAGTTTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021632.3-727s1c1
Sequence:CCGGGCTAACCATGAACGACTTCATCTCGAGATGAAGTCGTTCATGGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021632.3-1462s1c1
Sequence:CCGGGCGTATATGTCGTGTCTGGTTCTCGAGAACCAGACACGACATATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021632.3-661s1c1
Sequence:CCGGCAGAGCAAAGGCTATGAAATACTCGAGTATTTCATAGCCTTTGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021632.3-1666s1c1
Sequence:CCGGGCAAACAGGAACGTAGTCCTTCTCGAGAAGGACTACGTTCCTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021632
ZNF350 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 350
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021632.3-889s21c1
Sequence:CCGGCTAACTGATCACCAGGTAATGCTCGAGCATTACCTGGTGATCAGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424359    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021632.3-2010s21c1
Sequence:CCGGTTGCTCGACTGTGTCAATTAACTCGAGTTAATTGACACAGTCGAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021632.3-2152s21c1
Sequence:CCGGTTGGTGGGAAAGGGCTAATACCTCGAGGTATTAGCCCTTTCCCACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108060    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021632.3-1931s1c1
Sequence:CCGGCCTGATAAACTCATCCTATTACTCGAGTAATAGGATGAGTTTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021632.3-727s1c1
Sequence:CCGGGCTAACCATGAACGACTTCATCTCGAGATGAAGTCGTTCATGGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021632.3-1462s1c1
Sequence:CCGGGCGTATATGTCGTGTCTGGTTCTCGAGAACCAGACACGACATATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021632.3-661s1c1
Sequence:CCGGCAGAGCAAAGGCTATGAAATACTCGAGTATTTCATAGCCTTTGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021632.3-1666s1c1
Sequence:CCGGGCAAACAGGAACGTAGTCCTTCTCGAGAAGGACTACGTTCCTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks