EMAIL THIS PAGE TO A FRIEND

ZNF354A

zinc finger protein 354A

Synonyms: EZNF HKL1 KID-1 KID1 TCF17
UniProtKB ID: O60765, Q9UNJ8
Gene ID:
dog(100688159) zinc finger protein 354A
Horse(100068186) zinc finger protein 354A
domestic cat(101087636) zinc finger protein 354A
cow(524106) zinc finger protein 354A
sheep(101104486) zinc finger protein 354A
domestic guinea pig(100723771) zinc finger protein 354A
23 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005649 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005649 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005649 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU152511 MISSION® esiRNA esiRNA human ZNF354A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005649 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005649 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083271 predicted 780
2 SASI_Hs01_00083272 predicted 572
3 SASI_Hs01_00083273 predicted 542
4 SASI_Hs02_00340010 predicted 1216
5 SASI_Hs01_00083274 predicted 255
6 SASI_Hs01_00083275 predicted 2005
7 SASI_Hs01_00083277 predicted 480
8 SASI_Hs01_00083279 predicted 1193
9 SASI_Hs02_00340011 predicted 774
10 SASI_Hs02_00340012 predicted 1035
11 SASI_Hs01_00083270 predicted 2052
12 SASI_Hs01_00083276 predicted 785
13 SASI_Hs01_00083278 predicted 487
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005649
VALIDATED
ZNF354A MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 354A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005649.2-2125s1c1
Sequence:CCGGGCCCTCATTAGGTATTTAATTCTCGAGAATTAAATACCTAATGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005649.2-485s1c1
Sequence:CCGGCAACGCAAACACAAGACTCTTCTCGAGAAGAGTCTTGTGTTTGCGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005649.2-1037s1c1
Sequence:CCGGCTCTCAGTACATCCCTTTATACTCGAGTATAAAGGGATGTACTGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005649.2-1802s1c1
Sequence:CCGGCAGCTCTTATTCAGCATCGAACTCGAGTTCGATGCTGAATAAGAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005649.2-704s1c1
Sequence:CCGGGCCCAAAGTCAGTGCTTATTACTCGAGTAATAAGCACTGACTTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005649.2-703s21c1
Sequence:CCGGAGCCCAAAGTCAGTGCTTATTCTCGAGAATAAGCACTGACTTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005649.2-1215s21c1
Sequence:CCGGATCCCTTTCTGGATGTCAAAGCTCGAGCTTTGACATCCAGAAAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005649.2-490s21c1
Sequence:CCGGCAAACACAAGACTCTTCATTTCTCGAGAAATGAAGAGTCTTGTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005649.2-1038s21c1
Sequence:CCGGTCTCAGTACATCCCTTTATAACTCGAGTTATAAAGGGATGTACTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005649.2-2122s21c1
Sequence:CCGGTTAGCCCTCATTAGGTATTTACTCGAGTAAATACCTAATGAGGGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005649
VALIDATED
ZNF354A MISSION shRNA shRNA Plasmid DNA
zinc finger protein 354A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005649.2-2125s1c1
Sequence:CCGGGCCCTCATTAGGTATTTAATTCTCGAGAATTAAATACCTAATGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005649.2-485s1c1
Sequence:CCGGCAACGCAAACACAAGACTCTTCTCGAGAAGAGTCTTGTGTTTGCGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005649.2-1037s1c1
Sequence:CCGGCTCTCAGTACATCCCTTTATACTCGAGTATAAAGGGATGTACTGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005649.2-1802s1c1
Sequence:CCGGCAGCTCTTATTCAGCATCGAACTCGAGTTCGATGCTGAATAAGAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005649.2-704s1c1
Sequence:CCGGGCCCAAAGTCAGTGCTTATTACTCGAGTAATAAGCACTGACTTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005649.2-703s21c1
Sequence:CCGGAGCCCAAAGTCAGTGCTTATTCTCGAGAATAAGCACTGACTTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005649.2-1215s21c1
Sequence:CCGGATCCCTTTCTGGATGTCAAAGCTCGAGCTTTGACATCCAGAAAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005649.2-490s21c1
Sequence:CCGGCAAACACAAGACTCTTCATTTCTCGAGAAATGAAGAGTCTTGTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005649.2-1038s21c1
Sequence:CCGGTCTCAGTACATCCCTTTATAACTCGAGTTATAAAGGGATGTACTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005649.2-2122s21c1
Sequence:CCGGTTAGCCCTCATTAGGTATTTACTCGAGTAAATACCTAATGAGGGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005649
VALIDATED
ZNF354A MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 354A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005649.2-2125s1c1
Sequence:CCGGGCCCTCATTAGGTATTTAATTCTCGAGAATTAAATACCTAATGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005649.2-485s1c1
Sequence:CCGGCAACGCAAACACAAGACTCTTCTCGAGAAGAGTCTTGTGTTTGCGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005649.2-1037s1c1
Sequence:CCGGCTCTCAGTACATCCCTTTATACTCGAGTATAAAGGGATGTACTGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005649.2-1802s1c1
Sequence:CCGGCAGCTCTTATTCAGCATCGAACTCGAGTTCGATGCTGAATAAGAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005649.2-704s1c1
Sequence:CCGGGCCCAAAGTCAGTGCTTATTACTCGAGTAATAAGCACTGACTTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005649.2-703s21c1
Sequence:CCGGAGCCCAAAGTCAGTGCTTATTCTCGAGAATAAGCACTGACTTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005649.2-1215s21c1
Sequence:CCGGATCCCTTTCTGGATGTCAAAGCTCGAGCTTTGACATCCAGAAAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005649.2-490s21c1
Sequence:CCGGCAAACACAAGACTCTTCATTTCTCGAGAAATGAAGAGTCTTGTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005649.2-1038s21c1
Sequence:CCGGTCTCAGTACATCCCTTTATAACTCGAGTTATAAAGGGATGTACTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005649.2-2122s21c1
Sequence:CCGGTTAGCCCTCATTAGGTATTTACTCGAGTAAATACCTAATGAGGGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks