EMAIL THIS PAGE TO A FRIEND

ZNF354B

zinc finger protein 354B

Synonyms: KID2
UniProtKB ID: Q96LW1, A8K0V2, Q5U5Z4
Gene ID:
domestic guinea pig(100722937) zinc finger protein 354B
Domestic Rabbit(100345280) zinc finger protein 354B
naked mole-rat(101716670) zinc finger protein 354B
sheep(101104313) zinc finger protein 354B
Horse(100067884) zinc finger protein 354B
domestic cat(101086622) zinc finger protein 354B
dog(474648) zinc finger protein 354B
18 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_058230 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_058230 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_058230 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU033211 MISSION® esiRNA esiRNA human ZNF354B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_058230 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_058230 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068087 predicted 511
2 SASI_Hs01_00068088 predicted 470
3 SASI_Hs01_00068089 predicted 1054
4 SASI_Hs01_00068090 predicted 679
5 SASI_Hs01_00068091 predicted 1019
6 SASI_Hs01_00068092 predicted 1180
7 SASI_Hs01_00068093 predicted 1181
8 SASI_Hs01_00068094 predicted 1770
9 SASI_Hs01_00068095 predicted 1221
10 SASI_Hs01_00068096 predicted 758
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_058230
VALIDATED
ZNF354B MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 354B
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058230.2-2026s21c1
Sequence:CCGGCATTGAAGAGGACTCCTTAAACTCGAGTTTAAGGAGTCCTCTTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058230.2-1109s21c1
Sequence:CCGGGAGAAATGCTATAGATGTAAACTCGAGTTTACATCTATAGCATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058230.2-515s21c1
Sequence:CCGGACTCAAACTCAGGATTCATTTCTCGAGAAATGAATCCTGAGTTTGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058230.2-294s21c1
Sequence:CCGGTTACCTGGGATGAGTGGAGAACTCGAGTTCTCCACTCATCCCAGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058230.2-654s21c1
Sequence:CCGGTAATTTCAGTTGCCCATACAACTCGAGTTGTATGGGCAACTGAAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058230.2-1797s21c1
Sequence:CCGGGTTTAGAATGTGGGATGTCTTCTCGAGAAGACATCCCACATTCTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058230.2-751s21c1
Sequence:CCGGGCAACAGAGATTTGCTAAAGACTCGAGTCTTTAGCAAATCTCTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058230.2-1269s21c1
Sequence:CCGGATCTCAGAAAGAAGTCCTACTCTCGAGAGTAGGACTTCTTTCTGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058230.2-1231s21c1
Sequence:CCGGCAGTTACAGCACTTCCCTTTCCTCGAGGAAAGGGAAGTGCTGTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058230.2-384s21c1
Sequence:CCGGTGGGACTCTCATTTACCAAACCTCGAGGTTTGGTAAATGAGAGTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_058230.1-1019s1c1
Sequence:CCGGCCATAGTGCATCCCTTTGTAACTCGAGTTACAAAGGGATGCACTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058230.1-550s1c1
Sequence:CCGGCCTGCATATATGAAGAGAAATCTCGAGATTTCTCTTCATATATGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058230.1-525s1c1
Sequence:CCGGCCCTGGAACTTCATATCAGAACTCGAGTTCTGATATGAAGTTCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058230.1-1867s1c1
Sequence:CCGGCATCACTTATTGCACATCAAACTCGAGTTTGATGTGCAATAAGTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_058230
VALIDATED
ZNF354B MISSION shRNA shRNA Plasmid DNA
zinc finger protein 354B
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058230.2-2026s21c1
Sequence:CCGGCATTGAAGAGGACTCCTTAAACTCGAGTTTAAGGAGTCCTCTTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058230.2-1109s21c1
Sequence:CCGGGAGAAATGCTATAGATGTAAACTCGAGTTTACATCTATAGCATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058230.2-515s21c1
Sequence:CCGGACTCAAACTCAGGATTCATTTCTCGAGAAATGAATCCTGAGTTTGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058230.2-294s21c1
Sequence:CCGGTTACCTGGGATGAGTGGAGAACTCGAGTTCTCCACTCATCCCAGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058230.2-654s21c1
Sequence:CCGGTAATTTCAGTTGCCCATACAACTCGAGTTGTATGGGCAACTGAAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058230.2-1797s21c1
Sequence:CCGGGTTTAGAATGTGGGATGTCTTCTCGAGAAGACATCCCACATTCTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058230.2-751s21c1
Sequence:CCGGGCAACAGAGATTTGCTAAAGACTCGAGTCTTTAGCAAATCTCTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058230.2-1269s21c1
Sequence:CCGGATCTCAGAAAGAAGTCCTACTCTCGAGAGTAGGACTTCTTTCTGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058230.2-1231s21c1
Sequence:CCGGCAGTTACAGCACTTCCCTTTCCTCGAGGAAAGGGAAGTGCTGTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058230.2-384s21c1
Sequence:CCGGTGGGACTCTCATTTACCAAACCTCGAGGTTTGGTAAATGAGAGTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_058230.1-1019s1c1
Sequence:CCGGCCATAGTGCATCCCTTTGTAACTCGAGTTACAAAGGGATGCACTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058230.1-550s1c1
Sequence:CCGGCCTGCATATATGAAGAGAAATCTCGAGATTTCTCTTCATATATGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058230.1-525s1c1
Sequence:CCGGCCCTGGAACTTCATATCAGAACTCGAGTTCTGATATGAAGTTCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058230.1-1867s1c1
Sequence:CCGGCATCACTTATTGCACATCAAACTCGAGTTTGATGTGCAATAAGTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_058230
VALIDATED
ZNF354B MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 354B
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058230.2-2026s21c1
Sequence:CCGGCATTGAAGAGGACTCCTTAAACTCGAGTTTAAGGAGTCCTCTTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058230.2-1109s21c1
Sequence:CCGGGAGAAATGCTATAGATGTAAACTCGAGTTTACATCTATAGCATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058230.2-515s21c1
Sequence:CCGGACTCAAACTCAGGATTCATTTCTCGAGAAATGAATCCTGAGTTTGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058230.2-294s21c1
Sequence:CCGGTTACCTGGGATGAGTGGAGAACTCGAGTTCTCCACTCATCCCAGGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058230.2-654s21c1
Sequence:CCGGTAATTTCAGTTGCCCATACAACTCGAGTTGTATGGGCAACTGAAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058230.2-1797s21c1
Sequence:CCGGGTTTAGAATGTGGGATGTCTTCTCGAGAAGACATCCCACATTCTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058230.2-751s21c1
Sequence:CCGGGCAACAGAGATTTGCTAAAGACTCGAGTCTTTAGCAAATCTCTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058230.2-1269s21c1
Sequence:CCGGATCTCAGAAAGAAGTCCTACTCTCGAGAGTAGGACTTCTTTCTGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058230.2-1231s21c1
Sequence:CCGGCAGTTACAGCACTTCCCTTTCCTCGAGGAAAGGGAAGTGCTGTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058230.2-384s21c1
Sequence:CCGGTGGGACTCTCATTTACCAAACCTCGAGGTTTGGTAAATGAGAGTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_058230.1-1019s1c1
Sequence:CCGGCCATAGTGCATCCCTTTGTAACTCGAGTTACAAAGGGATGCACTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058230.1-550s1c1
Sequence:CCGGCCTGCATATATGAAGAGAAATCTCGAGATTTCTCTTCATATATGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058230.1-525s1c1
Sequence:CCGGCCCTGGAACTTCATATCAGAACTCGAGTTCTGATATGAAGTTCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_058230.1-1867s1c1
Sequence:CCGGCATCACTTATTGCACATCAAACTCGAGTTTGATGTGCAATAAGTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks