EMAIL THIS PAGE TO A FRIEND

ZNF354C

zinc finger protein 354C

Synonyms: KID3
UniProtKB ID: Q86Y25, Q6P4P9, Q8NFX1
Gene ID:
Horse(100147055) zinc finger protein 354C
domestic cat(101097203) zinc finger protein 354C
dog(100687690) zinc finger protein 354C
cow(523334) zinc finger protein 354C
sheep(101120829) zinc finger protein 354C
naked mole-rat(101711085) zinc finger protein 354C
domestic guinea pig(100721840) zinc finger protein 354C
22 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA030904 Anti-ZNF354C antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014594 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014594 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014594 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU051061 MISSION® esiRNA esiRNA human ZNF354C (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014594 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014594 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345875 predicted 1463
2 SASI_Hs01_00088644 predicted 442
3 SASI_Hs01_00088646 predicted 1040
4 SASI_Hs01_00088647 predicted 1633
5 SASI_Hs01_00088649 predicted 1286
6 SASI_Hs02_00345876 predicted 1634
7 SASI_Hs01_00088652 predicted 1389
8 SASI_Hs01_00088653 predicted 650
9 SASI_Hs02_00345877 predicted 1829
10 SASI_Hs02_00345878 predicted 492
11 SASI_Hs01_00088645 predicted 1770
12 SASI_Hs01_00088648 predicted 541
13 SASI_Hs01_00088650 predicted 677
14 SASI_Hs01_00088651 predicted 969
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014594
ZNF354C MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 354C
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014594.1-357s1c1
Sequence:CCGGCCCGTCTAGGTTTCAAGACTTCTCGAGAAGTCTTGAAACCTAGACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014594.1-588s1c1
Sequence:CCGGGAAACCATACAAGTCTTGAATCTCGAGATTCAAGACTTGTATGGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014594.1-1730s1c1
Sequence:CCGGCTTACCCAGTATCAGAGATTTCTCGAGAAATCTCTGATACTGGGTAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014594.1-1298s1c1
Sequence:CCGGCGTATTGTAACCCTTATCGAACTCGAGTTCGATAAGGGTTACAATACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014594.1-1378s1c1
Sequence:CCGGCAACCAGTATTCATCCTTTAACTCGAGTTAAAGGATGAATACTGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014594
ZNF354C MISSION shRNA shRNA Plasmid DNA
zinc finger protein 354C
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014594.1-357s1c1
Sequence:CCGGCCCGTCTAGGTTTCAAGACTTCTCGAGAAGTCTTGAAACCTAGACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014594.1-588s1c1
Sequence:CCGGGAAACCATACAAGTCTTGAATCTCGAGATTCAAGACTTGTATGGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014594.1-1730s1c1
Sequence:CCGGCTTACCCAGTATCAGAGATTTCTCGAGAAATCTCTGATACTGGGTAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014594.1-1298s1c1
Sequence:CCGGCGTATTGTAACCCTTATCGAACTCGAGTTCGATAAGGGTTACAATACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014594.1-1378s1c1
Sequence:CCGGCAACCAGTATTCATCCTTTAACTCGAGTTAAAGGATGAATACTGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014594
ZNF354C MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 354C
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014594.1-357s1c1
Sequence:CCGGCCCGTCTAGGTTTCAAGACTTCTCGAGAAGTCTTGAAACCTAGACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014594.1-588s1c1
Sequence:CCGGGAAACCATACAAGTCTTGAATCTCGAGATTCAAGACTTGTATGGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014594.1-1730s1c1
Sequence:CCGGCTTACCCAGTATCAGAGATTTCTCGAGAAATCTCTGATACTGGGTAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014594.1-1298s1c1
Sequence:CCGGCGTATTGTAACCCTTATCGAACTCGAGTTCGATAAGGGTTACAATACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014594.1-1378s1c1
Sequence:CCGGCAACCAGTATTCATCCTTTAACTCGAGTTAAAGGATGAATACTGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks