EMAIL THIS PAGE TO A FRIEND

ZNF358

zinc finger protein 358

Synonyms: ZFEND
UniProtKB ID: Q9NW07, Q9BTM7
Gene ID:
dog(611506) zinc finger protein 358
domestic cat(101080767) zinc finger protein 358
domestic guinea pig(100713920) zinc finger protein 358
naked mole-rat(101723926) zinc finger protein 358
cow(505837) zinc finger protein 358
sheep(101121258) zinc finger protein 358
25 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018083 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018083 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018083 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU100571 MISSION® esiRNA esiRNA human ZNF358 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018083 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018083 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071485 predicted 965
2 SASI_Hs01_00071486 predicted 962
3 SASI_Hs01_00071487 predicted 1136
4 SASI_Hs02_00351245 predicted 1035
5 SASI_Hs01_00071489 predicted 868
6 SASI_Hs02_00351246 predicted 359
7 SASI_Hs01_00071491 predicted 1139
8 SASI_Hs02_00351247 predicted 355
9 SASI_Hs02_00351248 predicted 904
10 SASI_Hs02_00351249 predicted 1041
11 SASI_Hs01_00071483 predicted 751
12 SASI_Hs01_00071484 predicted 750
13 SASI_Hs01_00071488 predicted 758
14 SASI_Hs01_00071490 predicted 813
15 SASI_Hs01_00071492 predicted 751
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018083
VALIDATED
ZNF358 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 358
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018083.2-1556s1c1
Sequence:CCGGCCAGCCCTACTCCTGTGGAATCTCGAGATTCCACAGGAGTAGGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018083.2-1573s1c1
Sequence:CCGGGAATCTTCTGACCCAAAGGCTCTCGAGAGCCTTTGGGTCAGAAGATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018083.2-364s1c1
Sequence:CCGGTCTTCGAGTTTCGACCTCGATCTCGAGATCGAGGTCGAAACTCGAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018083.2-407s1c1
Sequence:CCGGCCCTGATTCTCGATCCTAACACTCGAGTGTTAGGATCGAGAATCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018083.2-233s1c1
Sequence:CCGGCTGATCCTGAAGACCTCAACACTCGAGTGTTGAGGTCTTCAGGATCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018083.4-1483s21c1
Sequence:CCGGTGGGTCCTGATGCTGTTTCTGCTCGAGCAGAAACAGCATCAGGACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018083.4-1160s21c1
Sequence:CCGGGAGCTCCAACTTGCAACACCACTCGAGTGGTGTTGCAAGTTGGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018083
VALIDATED
ZNF358 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 358
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018083.2-1556s1c1
Sequence:CCGGCCAGCCCTACTCCTGTGGAATCTCGAGATTCCACAGGAGTAGGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018083.2-1573s1c1
Sequence:CCGGGAATCTTCTGACCCAAAGGCTCTCGAGAGCCTTTGGGTCAGAAGATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018083.2-364s1c1
Sequence:CCGGTCTTCGAGTTTCGACCTCGATCTCGAGATCGAGGTCGAAACTCGAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018083.2-407s1c1
Sequence:CCGGCCCTGATTCTCGATCCTAACACTCGAGTGTTAGGATCGAGAATCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018083.2-233s1c1
Sequence:CCGGCTGATCCTGAAGACCTCAACACTCGAGTGTTGAGGTCTTCAGGATCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018083.4-1483s21c1
Sequence:CCGGTGGGTCCTGATGCTGTTTCTGCTCGAGCAGAAACAGCATCAGGACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018083.4-1160s21c1
Sequence:CCGGGAGCTCCAACTTGCAACACCACTCGAGTGGTGTTGCAAGTTGGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018083
VALIDATED
ZNF358 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 358
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018083.2-1556s1c1
Sequence:CCGGCCAGCCCTACTCCTGTGGAATCTCGAGATTCCACAGGAGTAGGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018083.2-1573s1c1
Sequence:CCGGGAATCTTCTGACCCAAAGGCTCTCGAGAGCCTTTGGGTCAGAAGATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018083.2-364s1c1
Sequence:CCGGTCTTCGAGTTTCGACCTCGATCTCGAGATCGAGGTCGAAACTCGAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018083.2-407s1c1
Sequence:CCGGCCCTGATTCTCGATCCTAACACTCGAGTGTTAGGATCGAGAATCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018083.2-233s1c1
Sequence:CCGGCTGATCCTGAAGACCTCAACACTCGAGTGTTGAGGTCTTCAGGATCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018083.4-1483s21c1
Sequence:CCGGTGGGTCCTGATGCTGTTTCTGCTCGAGCAGAAACAGCATCAGGACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018083.4-1160s21c1
Sequence:CCGGGAGCTCCAACTTGCAACACCACTCGAGTGGTGTTGCAAGTTGGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks