EMAIL THIS PAGE TO A FRIEND

ZNF35

zinc finger protein 35

Synonyms: HF.10 HF10 Zfp105
UniProtKB ID: P13682, B2RBU6, Q53Y54, Q96D01
Gene ID:
Horse(100066026) zinc finger protein 35
dog(100856101) zinc finger protein 35
domestic cat(101099899) zinc finger protein 35
cow(782819) zinc finger protein 35
sheep(101120278) zinc finger protein 35
Domestic Rabbit(100344151) zinc finger protein 35
naked mole-rat(101729898) zinc finger protein 35
domestic guinea pig(101787246) zinc finger protein 35
22 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003420 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003420 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003420 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU042191 MISSION® esiRNA esiRNA human ZNF35 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003420 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003420 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184890 predicted 831
2 SASI_Hs01_00184891 predicted 1087
3 SASI_Hs01_00184892 predicted 1003
4 SASI_Hs01_00184893 predicted 1715
5 SASI_Hs01_00184894 predicted 759
6 SASI_Hs01_00184895 predicted 1589
7 SASI_Hs01_00184896 predicted 1193
8 SASI_Hs01_00184897 predicted 513
9 SASI_Hs01_00184898 predicted 575
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003420
VALIDATED
ZNF35 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 35
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014978    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003420.2-2476s1c1
Sequence:CCGGCCAGCTATATTCATTTGCCAACTCGAGTTGGCAAATGAATATAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003420.2-603s1c1
Sequence:CCGGCCCTCATCATATCAGAAAGAACTCGAGTTCTTTCTGATATGATGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003420.2-393s1c1
Sequence:CCGGGTCAGAACATATCCTGGGATACTCGAGTATCCCAGGATATGTTCTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003420.2-1568s1c1
Sequence:CCGGTGTAGCTCATACCTACTTATTCTCGAGAATAAGTAGGTATGAGCTACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003420.2-811s1c1
Sequence:CCGGCCTTAATTCTGGCGCTGTTAACTCGAGTTAACAGCGCCAGAATTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003420.3-1189s21c1
Sequence:CCGGGGCACCAGAAAGTCCACATTACTCGAGTAATGTGGACTTTCTGGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003420.3-1503s21c1
Sequence:CCGGAGTCAGCTCTCTTGCCTTATTCTCGAGAATAAGGCAAGAGAGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003420.3-1784s21c1
Sequence:CCGGTAGAACCCATCTTGTTGAATACTCGAGTATTCAACAAGATGGGTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003420.3-480s21c1
Sequence:CCGGACCCTTGGCAGCTACTCATTACTCGAGTAATGAGTAGCTGCCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271304    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003420.3-1823s21c1
Sequence:CCGGGACCTCCAGCATTGGTCATAACTCGAGTTATGACCAATGCTGGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003420
VALIDATED
ZNF35 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 35
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014978    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003420.2-2476s1c1
Sequence:CCGGCCAGCTATATTCATTTGCCAACTCGAGTTGGCAAATGAATATAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003420.2-603s1c1
Sequence:CCGGCCCTCATCATATCAGAAAGAACTCGAGTTCTTTCTGATATGATGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003420.2-393s1c1
Sequence:CCGGGTCAGAACATATCCTGGGATACTCGAGTATCCCAGGATATGTTCTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003420.2-1568s1c1
Sequence:CCGGTGTAGCTCATACCTACTTATTCTCGAGAATAAGTAGGTATGAGCTACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003420.2-811s1c1
Sequence:CCGGCCTTAATTCTGGCGCTGTTAACTCGAGTTAACAGCGCCAGAATTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003420.3-1189s21c1
Sequence:CCGGGGCACCAGAAAGTCCACATTACTCGAGTAATGTGGACTTTCTGGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003420.3-1503s21c1
Sequence:CCGGAGTCAGCTCTCTTGCCTTATTCTCGAGAATAAGGCAAGAGAGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003420.3-1784s21c1
Sequence:CCGGTAGAACCCATCTTGTTGAATACTCGAGTATTCAACAAGATGGGTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003420.3-480s21c1
Sequence:CCGGACCCTTGGCAGCTACTCATTACTCGAGTAATGAGTAGCTGCCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271304    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003420.3-1823s21c1
Sequence:CCGGGACCTCCAGCATTGGTCATAACTCGAGTTATGACCAATGCTGGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003420
VALIDATED
ZNF35 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 35
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014978    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003420.2-2476s1c1
Sequence:CCGGCCAGCTATATTCATTTGCCAACTCGAGTTGGCAAATGAATATAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003420.2-603s1c1
Sequence:CCGGCCCTCATCATATCAGAAAGAACTCGAGTTCTTTCTGATATGATGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003420.2-393s1c1
Sequence:CCGGGTCAGAACATATCCTGGGATACTCGAGTATCCCAGGATATGTTCTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003420.2-1568s1c1
Sequence:CCGGTGTAGCTCATACCTACTTATTCTCGAGAATAAGTAGGTATGAGCTACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003420.2-811s1c1
Sequence:CCGGCCTTAATTCTGGCGCTGTTAACTCGAGTTAACAGCGCCAGAATTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003420.3-1189s21c1
Sequence:CCGGGGCACCAGAAAGTCCACATTACTCGAGTAATGTGGACTTTCTGGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003420.3-1503s21c1
Sequence:CCGGAGTCAGCTCTCTTGCCTTATTCTCGAGAATAAGGCAAGAGAGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003420.3-1784s21c1
Sequence:CCGGTAGAACCCATCTTGTTGAATACTCGAGTATTCAACAAGATGGGTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003420.3-480s21c1
Sequence:CCGGACCCTTGGCAGCTACTCATTACTCGAGTAATGAGTAGCTGCCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271304    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003420.3-1823s21c1
Sequence:CCGGGACCTCCAGCATTGGTCATAACTCGAGTTATGACCAATGCTGGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks