EMAIL THIS PAGE TO A FRIEND

ZNF362

zinc finger protein 362

Synonyms: RN lin-29
UniProtKB ID: Q5T0B9, Q8WYU4
Gene ID:
cow(508065) zinc finger protein 362
sheep(101103956) zinc finger protein 362
naked mole-rat(101700060) zinc finger protein 362
Domestic Rabbit(100351791) zinc finger protein 362
domestic guinea pig(100733794) zinc finger protein 362
Zebrafish(777625) zinc finger protein 362
domestic cat(101082074) zinc finger protein 362
dog(487299) zinc finger protein 362
chicken(100859829) zinc finger protein 362
171 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152493 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152493 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152493 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU045751 MISSION® esiRNA esiRNA human ZNF362 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152493 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152493 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016446 predicted 1323
2 SASI_Hs01_00016447 predicted 1276
3 SASI_Hs01_00016448 predicted 1107
4 SASI_Hs01_00016449 predicted 837
5 SASI_Hs01_00016450 predicted 1212
6 SASI_Hs01_00016451 predicted 1284
7 SASI_Hs01_00016452 predicted 826
8 SASI_Hs01_00016453 predicted 1152
9 SASI_Hs01_00016454 predicted 1315
10 SASI_Hs01_00016455 predicted 1410
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152493
VALIDATED
ZNF362 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 362
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_152493.2-209s21c1
Sequence:CCGGGATGGCCGAGCCTCGATTTAACTCGAGTTAAATCGAGGCTCGGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_152493.2-1409s21c1
Sequence:CCGGCCCGGTGCGAATCTCTCTCATCTCGAGATGAGAGAGATTCGCACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152493.2-278s21c1
Sequence:CCGGCAACCTGGTTCTGATTAACAACTCGAGTTGTTAATCAGAACCAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_152493.2-1019s21c1
Sequence:CCGGCCACTGCTCCTACTGTGATAACTCGAGTTATCACAGTAGGAGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107765    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152493.2-2774s1c1
Sequence:CCGGCCCTGTAAATACGCTGTTATACTCGAGTATAACAGCGTATTTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152493.2-1409s1c1
Sequence:CCGGCCCGGTGCGAATCTCTCTCATCTCGAGATGAGAGAGATTCGCACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152493.2-278s1c1
Sequence:CCGGCAACCTGGTTCTGATTAACAACTCGAGTTGTTAATCAGAACCAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152493.2-1019s1c1
Sequence:CCGGCCACTGCTCCTACTGTGATAACTCGAGTTATCACAGTAGGAGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152493.2-1217s1c1
Sequence:CCGGCTATTCGGACTCCGCTTCTTTCTCGAGAAAGAAGCGGAGTCCGAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152493
VALIDATED
ZNF362 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 362
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_152493.2-209s21c1
Sequence:CCGGGATGGCCGAGCCTCGATTTAACTCGAGTTAAATCGAGGCTCGGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_152493.2-1409s21c1
Sequence:CCGGCCCGGTGCGAATCTCTCTCATCTCGAGATGAGAGAGATTCGCACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152493.2-278s21c1
Sequence:CCGGCAACCTGGTTCTGATTAACAACTCGAGTTGTTAATCAGAACCAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_152493.2-1019s21c1
Sequence:CCGGCCACTGCTCCTACTGTGATAACTCGAGTTATCACAGTAGGAGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107765    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152493.2-2774s1c1
Sequence:CCGGCCCTGTAAATACGCTGTTATACTCGAGTATAACAGCGTATTTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152493.2-1409s1c1
Sequence:CCGGCCCGGTGCGAATCTCTCTCATCTCGAGATGAGAGAGATTCGCACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152493.2-278s1c1
Sequence:CCGGCAACCTGGTTCTGATTAACAACTCGAGTTGTTAATCAGAACCAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152493.2-1019s1c1
Sequence:CCGGCCACTGCTCCTACTGTGATAACTCGAGTTATCACAGTAGGAGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152493.2-1217s1c1
Sequence:CCGGCTATTCGGACTCCGCTTCTTTCTCGAGAAAGAAGCGGAGTCCGAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152493
VALIDATED
ZNF362 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 362
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_152493.2-209s21c1
Sequence:CCGGGATGGCCGAGCCTCGATTTAACTCGAGTTAAATCGAGGCTCGGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_152493.2-1409s21c1
Sequence:CCGGCCCGGTGCGAATCTCTCTCATCTCGAGATGAGAGAGATTCGCACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152493.2-278s21c1
Sequence:CCGGCAACCTGGTTCTGATTAACAACTCGAGTTGTTAATCAGAACCAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_152493.2-1019s21c1
Sequence:CCGGCCACTGCTCCTACTGTGATAACTCGAGTTATCACAGTAGGAGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107765    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152493.2-2774s1c1
Sequence:CCGGCCCTGTAAATACGCTGTTATACTCGAGTATAACAGCGTATTTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152493.2-1409s1c1
Sequence:CCGGCCCGGTGCGAATCTCTCTCATCTCGAGATGAGAGAGATTCGCACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152493.2-278s1c1
Sequence:CCGGCAACCTGGTTCTGATTAACAACTCGAGTTGTTAATCAGAACCAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152493.2-1019s1c1
Sequence:CCGGCCACTGCTCCTACTGTGATAACTCGAGTTATCACAGTAGGAGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_152493.2-1217s1c1
Sequence:CCGGCTATTCGGACTCCGCTTCTTTCTCGAGAAAGAAGCGGAGTCCGAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks