EMAIL THIS PAGE TO A FRIEND

ZNF365

zinc finger protein 365

Synonyms: Su48 UAN ZNF365D
UniProtKB ID: Q70YC4
Gene ID:
Human(22891) Summary: This gene encodes several isoforms which have different expression patterns and functions. Mutation in this gene is associated with uric acid nephrolithiasis (UAN). Alternatively spliced variants, encoding distinct proteins, have been identified. [provided by RefSeq, May 2010]
chicken(423658) zinc finger protein 365
dog(489002) zinc finger protein 365
domestic cat(101082011) zinc finger protein 365
Horse(100062862) zinc finger protein 365
domestic guinea pig(100716744) zinc finger protein 365
naked mole-rat(101713396) zinc finger protein 365
sheep(101122160) zinc finger protein 365
216 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199450 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199450 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199450 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014951 Rosetta Predictions human pricing
NM_199450 Rosetta Predictions human pricing
NM_199451 Rosetta Predictions human pricing
NM_199452 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014951 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151392 predicted 950
2 SASI_Hs01_00151393 predicted 593
3 SASI_Hs01_00151394 predicted 836
4 SASI_Hs01_00151396 predicted 526
5 SASI_Hs01_00151397 predicted 821
6 SASI_Hs01_00151398 predicted 1008
7 SASI_Hs01_00151399 predicted 515
8 SASI_Hs01_00151400 predicted 703
9 SASI_Hs01_00151401 predicted 570
10 SASI_Hs02_00346630 predicted 847
11 SASI_Hs01_00151395 predicted 562
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199450 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094428 predicted 941
2 SASI_Hs01_00094429 predicted 586
3 SASI_Hs01_00094430 predicted 831
4 SASI_Hs01_00094432 predicted 525
5 SASI_Hs01_00094433 predicted 819
6 SASI_Hs01_00094434 predicted 1002
7 SASI_Hs01_00094435 predicted 520
8 SASI_Hs01_00094436 predicted 701
9 SASI_Hs01_00094437 predicted 568
10 SASI_Hs02_00372857 predicted 850
11 SASI_Hs01_00094431 predicted 561
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199451 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062825 predicted 948
2 SASI_Hs01_00062826 predicted 591
3 SASI_Hs01_00062827 predicted 835
4 SASI_Hs02_00372858 predicted 1060
5 SASI_Hs01_00062829 predicted 524
6 SASI_Hs02_00372859 predicted 826
7 SASI_Hs01_00062830 predicted 1076
8 SASI_Hs01_00062831 predicted 1006
9 SASI_Hs01_00062832 predicted 514
10 SASI_Hs01_00062833 predicted 704
11 SASI_Hs01_00062828 predicted 565
12 SASI_Hs01_00062834 predicted 541
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199452 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207464 predicted 913
2 SASI_Hs01_00207465 predicted 726
3 SASI_Hs01_00207466 predicted 837
4 SASI_Hs01_00207467 predicted 963
5 SASI_Hs01_00207468 predicted 1240
6 SASI_Hs01_00207469 predicted 1015
7 SASI_Hs01_00207470 predicted 927
8 SASI_Hs01_00207471 predicted 1230
9 SASI_Hs01_00207472 predicted 712
10 SASI_Hs01_00207473 predicted 695
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199450
ZNF365 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 365
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199450.1-1103s1c1
Sequence:CCGGGAGAATCTGTTACAGCGGGTACTCGAGTACCCGCTGTAACAGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128526    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199450.1-1402s1c1
Sequence:CCGGCTTTACAAGAAACTTGGGCTACTCGAGTAGCCCAAGTTTCTTGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199450.1-433s1c1
Sequence:CCGGCTACGAAGAAAGAACCCTCTTCTCGAGAAGAGGGTTCTTTCTTCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199450.1-998s1c1
Sequence:CCGGGAGGAGCTTCTTAGGAAAGAACTCGAGTTCTTTCCTAAGAAGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199450.1-556s1c1
Sequence:CCGGGCAGAAACCGAGCTATGTTAACTCGAGTTAACATAGCTCGGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199450.1-317s1c1
Sequence:CCGGCAGGAGTCCTTTGAGAATGTTCTCGAGAACATTCTCAAAGGACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199450.2-686s21c1
Sequence:CCGGCCTATGTGCAGACCTACACTGCTCGAGCAGTGTAGGTCTGCACATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199450.2-1298s21c1
Sequence:CCGGAGTCTGCGATTGTGGAATAATCTCGAGATTATTCCACAATCGCAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199450.2-503s21c1
Sequence:CCGGGTCTCTTTCCATCCCTCAAAGCTCGAGCTTTGAGGGATGGAAAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420139    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199450.2-1352s21c1
Sequence:CCGGTGGATCAAGAGAATCGCAAATCTCGAGATTTGCGATTCTCTTGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427283    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199450.2-1382s21c1
Sequence:CCGGCAGAGAAGCTTTCATTCATTCCTCGAGGAATGAATGAAAGCTTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199450
ZNF365 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 365
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199450.1-1103s1c1
Sequence:CCGGGAGAATCTGTTACAGCGGGTACTCGAGTACCCGCTGTAACAGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128526    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199450.1-1402s1c1
Sequence:CCGGCTTTACAAGAAACTTGGGCTACTCGAGTAGCCCAAGTTTCTTGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199450.1-433s1c1
Sequence:CCGGCTACGAAGAAAGAACCCTCTTCTCGAGAAGAGGGTTCTTTCTTCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199450.1-998s1c1
Sequence:CCGGGAGGAGCTTCTTAGGAAAGAACTCGAGTTCTTTCCTAAGAAGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199450.1-556s1c1
Sequence:CCGGGCAGAAACCGAGCTATGTTAACTCGAGTTAACATAGCTCGGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199450.1-317s1c1
Sequence:CCGGCAGGAGTCCTTTGAGAATGTTCTCGAGAACATTCTCAAAGGACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199450.2-686s21c1
Sequence:CCGGCCTATGTGCAGACCTACACTGCTCGAGCAGTGTAGGTCTGCACATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199450.2-1298s21c1
Sequence:CCGGAGTCTGCGATTGTGGAATAATCTCGAGATTATTCCACAATCGCAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199450.2-503s21c1
Sequence:CCGGGTCTCTTTCCATCCCTCAAAGCTCGAGCTTTGAGGGATGGAAAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420139    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199450.2-1352s21c1
Sequence:CCGGTGGATCAAGAGAATCGCAAATCTCGAGATTTGCGATTCTCTTGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427283    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199450.2-1382s21c1
Sequence:CCGGCAGAGAAGCTTTCATTCATTCCTCGAGGAATGAATGAAAGCTTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199450
ZNF365 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 365
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199450.1-1103s1c1
Sequence:CCGGGAGAATCTGTTACAGCGGGTACTCGAGTACCCGCTGTAACAGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128526    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199450.1-1402s1c1
Sequence:CCGGCTTTACAAGAAACTTGGGCTACTCGAGTAGCCCAAGTTTCTTGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199450.1-433s1c1
Sequence:CCGGCTACGAAGAAAGAACCCTCTTCTCGAGAAGAGGGTTCTTTCTTCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199450.1-998s1c1
Sequence:CCGGGAGGAGCTTCTTAGGAAAGAACTCGAGTTCTTTCCTAAGAAGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199450.1-556s1c1
Sequence:CCGGGCAGAAACCGAGCTATGTTAACTCGAGTTAACATAGCTCGGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199450.1-317s1c1
Sequence:CCGGCAGGAGTCCTTTGAGAATGTTCTCGAGAACATTCTCAAAGGACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199450.2-686s21c1
Sequence:CCGGCCTATGTGCAGACCTACACTGCTCGAGCAGTGTAGGTCTGCACATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199450.2-1298s21c1
Sequence:CCGGAGTCTGCGATTGTGGAATAATCTCGAGATTATTCCACAATCGCAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199450.2-503s21c1
Sequence:CCGGGTCTCTTTCCATCCCTCAAAGCTCGAGCTTTGAGGGATGGAAAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420139    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199450.2-1352s21c1
Sequence:CCGGTGGATCAAGAGAATCGCAAATCTCGAGATTTGCGATTCTCTTGATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427283    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199450.2-1382s21c1
Sequence:CCGGCAGAGAAGCTTTCATTCATTCCTCGAGGAATGAATGAAAGCTTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks