EMAIL THIS PAGE TO A FRIEND

ZNF366

zinc finger protein 366

Synonyms: DCSCRIPT
UniProtKB ID: Q8N895, Q5HYI9, Q7RTV4
Gene ID:
cow(539632) zinc finger protein 366
sheep(101109391) zinc finger protein 366
naked mole-rat(101712399) zinc finger protein 366
Domestic Rabbit(100339102) zinc finger protein 366
domestic guinea pig(100734947) zinc finger protein 366
Zebrafish(569695) zinc finger protein 366
chicken(431599) zinc finger protein 366
Horse(100073296) zinc finger protein 366
domestic cat(101092235) zinc finger protein 366
dog(487242) zinc finger protein 366
35 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152625 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152625 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152625 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU055291 MISSION® esiRNA esiRNA human ZNF366 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152625 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152625 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366489 predicted 439
2 SASI_Hs01_00071863 predicted 1949
3 SASI_Hs01_00071864 predicted 2520
4 SASI_Hs01_00071865 predicted 2458
5 SASI_Hs01_00071866 predicted 1524
6 SASI_Hs01_00071867 predicted 1722
7 SASI_Hs01_00071868 predicted 1623
8 SASI_Hs01_00071869 predicted 2412
9 SASI_Hs01_00071871 predicted 2505
10 SASI_Hs02_00366490 predicted 1536
11 SASI_Hs01_00071870 predicted 1538
12 SASI_Hs01_00071872 predicted 2332
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152625
ZNF366 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 366
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422017    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152625.1-2569s21c1
Sequence:CCGGGAAAGCCTTCTCAGGTCATTCCTCGAGGAATGACCTGAGAAGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152625.1-2529s21c1
Sequence:CCGGACAAATGGCTTAGACTAAATGCTCGAGCATTTAGTCTAAGCCATTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152625.1-1674s21c1
Sequence:CCGGGATCGTCCACTCTGACGTGAACTCGAGTTCACGTCAGAGTGGACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020134    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152625.1-2460s1c1
Sequence:CCGGAGGCAGTTCAAATATAGCTTTCTCGAGAAAGCTATATTTGAACTGCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152625.1-432s1c1
Sequence:CCGGGCCCACAAAGATGCCCTATAACTCGAGTTATAGGGCATCTTTGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152625.1-1800s1c1
Sequence:CCGGCCCAAGCAAATTCACCCTGAACTCGAGTTCAGGGTGAATTTGCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152625.1-631s1c1
Sequence:CCGGCCCGTCAAGCAGGAACCCATTCTCGAGAATGGGTTCCTGCTTGACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152625.1-2349s1c1
Sequence:CCGGGCACAGAGATGAGAGTTTGAACTCGAGTTCAAACTCTCATCTCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152625
ZNF366 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 366
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422017    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152625.1-2569s21c1
Sequence:CCGGGAAAGCCTTCTCAGGTCATTCCTCGAGGAATGACCTGAGAAGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152625.1-2529s21c1
Sequence:CCGGACAAATGGCTTAGACTAAATGCTCGAGCATTTAGTCTAAGCCATTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152625.1-1674s21c1
Sequence:CCGGGATCGTCCACTCTGACGTGAACTCGAGTTCACGTCAGAGTGGACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020134    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152625.1-2460s1c1
Sequence:CCGGAGGCAGTTCAAATATAGCTTTCTCGAGAAAGCTATATTTGAACTGCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152625.1-432s1c1
Sequence:CCGGGCCCACAAAGATGCCCTATAACTCGAGTTATAGGGCATCTTTGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152625.1-1800s1c1
Sequence:CCGGCCCAAGCAAATTCACCCTGAACTCGAGTTCAGGGTGAATTTGCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152625.1-631s1c1
Sequence:CCGGCCCGTCAAGCAGGAACCCATTCTCGAGAATGGGTTCCTGCTTGACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152625.1-2349s1c1
Sequence:CCGGGCACAGAGATGAGAGTTTGAACTCGAGTTCAAACTCTCATCTCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152625
ZNF366 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 366
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422017    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152625.1-2569s21c1
Sequence:CCGGGAAAGCCTTCTCAGGTCATTCCTCGAGGAATGACCTGAGAAGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152625.1-2529s21c1
Sequence:CCGGACAAATGGCTTAGACTAAATGCTCGAGCATTTAGTCTAAGCCATTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152625.1-1674s21c1
Sequence:CCGGGATCGTCCACTCTGACGTGAACTCGAGTTCACGTCAGAGTGGACGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020134    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152625.1-2460s1c1
Sequence:CCGGAGGCAGTTCAAATATAGCTTTCTCGAGAAAGCTATATTTGAACTGCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152625.1-432s1c1
Sequence:CCGGGCCCACAAAGATGCCCTATAACTCGAGTTATAGGGCATCTTTGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152625.1-1800s1c1
Sequence:CCGGCCCAAGCAAATTCACCCTGAACTCGAGTTCAGGGTGAATTTGCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152625.1-631s1c1
Sequence:CCGGCCCGTCAAGCAGGAACCCATTCTCGAGAATGGGTTCCTGCTTGACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152625.1-2349s1c1
Sequence:CCGGGCACAGAGATGAGAGTTTGAACTCGAGTTCAAACTCTCATCTCTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks