EMAIL THIS PAGE TO A FRIEND

ZNF367

zinc finger protein 367

Synonyms: AFF29 CDC14B ZFF29
UniProtKB ID: Q7RTV3, Q6Q7C8
Gene ID:
Zebrafish(550421) zinc finger protein 367
domestic cat(101085580) zinc finger protein 367
dog(476295) zinc finger protein 367
chicken(427474) zinc finger protein 367
domestic guinea pig(100727208) zinc finger protein 367
naked mole-rat(101715339) zinc finger protein 367
cow(540823) zinc finger protein 367
sheep(101113395) zinc finger protein 367
152 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153695 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153695 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153695 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU153491 MISSION® esiRNA esiRNA human ZNF367 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153695 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153695 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100191 predicted 1464
2 SASI_Hs01_00100192 predicted 1265
3 SASI_Hs01_00100193 predicted 926
4 SASI_Hs01_00100194 predicted 1126
5 SASI_Hs01_00100195 predicted 932
6 SASI_Hs01_00100196 predicted 1415
7 SASI_Hs01_00100197 predicted 1212
8 SASI_Hs01_00100198 predicted 1397
9 SASI_Hs01_00100199 predicted 943
10 SASI_Hs01_00100200 predicted 1271
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153695
VALIDATED
ZNF367 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 367
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_153695.2-804s1c1
Sequence:CCGGGCAGATACTGTCCGCGATTTACTCGAGTAAATCGCGGACAGTATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_153695.2-1272s1c1
Sequence:CCGGGAATACCTTCAGTCTGATGAACTCGAGTTCATCAGACTGAAGGTATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153695.2-946s1c1
Sequence:CCGGGTGACTATCCAGACTGTGGAACTCGAGTTCCACAGTCTGGATAGTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153695.2-853s1c1
Sequence:CCGGGAATCCGTTGTAACATCTGTACTCGAGTACAGATGTTACAACGGATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153695.2-1055s1c1
Sequence:CCGGGAGCAGATTCACCCATGCAAACTCGAGTTTGCATGGGTGAATCTGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153695.3-1657s21c1
Sequence:CCGGATATTGTGGGAAGCTAGATTTCTCGAGAAATCTAGCTTCCCACAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422269    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153695.3-1486s21c1
Sequence:CCGGCACCTTATTTGCTTATCATAGCTCGAGCTATGATAAGCAAATAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153695
VALIDATED
ZNF367 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 367
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_153695.2-804s1c1
Sequence:CCGGGCAGATACTGTCCGCGATTTACTCGAGTAAATCGCGGACAGTATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_153695.2-1272s1c1
Sequence:CCGGGAATACCTTCAGTCTGATGAACTCGAGTTCATCAGACTGAAGGTATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153695.2-946s1c1
Sequence:CCGGGTGACTATCCAGACTGTGGAACTCGAGTTCCACAGTCTGGATAGTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153695.2-853s1c1
Sequence:CCGGGAATCCGTTGTAACATCTGTACTCGAGTACAGATGTTACAACGGATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153695.2-1055s1c1
Sequence:CCGGGAGCAGATTCACCCATGCAAACTCGAGTTTGCATGGGTGAATCTGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153695.3-1657s21c1
Sequence:CCGGATATTGTGGGAAGCTAGATTTCTCGAGAAATCTAGCTTCCCACAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422269    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153695.3-1486s21c1
Sequence:CCGGCACCTTATTTGCTTATCATAGCTCGAGCTATGATAAGCAAATAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153695
VALIDATED
ZNF367 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 367
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_153695.2-804s1c1
Sequence:CCGGGCAGATACTGTCCGCGATTTACTCGAGTAAATCGCGGACAGTATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_153695.2-1272s1c1
Sequence:CCGGGAATACCTTCAGTCTGATGAACTCGAGTTCATCAGACTGAAGGTATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153695.2-946s1c1
Sequence:CCGGGTGACTATCCAGACTGTGGAACTCGAGTTCCACAGTCTGGATAGTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153695.2-853s1c1
Sequence:CCGGGAATCCGTTGTAACATCTGTACTCGAGTACAGATGTTACAACGGATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153695.2-1055s1c1
Sequence:CCGGGAGCAGATTCACCCATGCAAACTCGAGTTTGCATGGGTGAATCTGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427549    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153695.3-1657s21c1
Sequence:CCGGATATTGTGGGAAGCTAGATTTCTCGAGAAATCTAGCTTCCCACAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422269    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153695.3-1486s21c1
Sequence:CCGGCACCTTATTTGCTTATCATAGCTCGAGCTATGATAAGCAAATAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks