EMAIL THIS PAGE TO A FRIEND

ZNF37A

zinc finger protein 37A

Synonyms: KOX21 ZNF37
UniProtKB ID: P17032, B3KRQ3, D3DRZ3, Q96B88
Gene ID:
cow(100138488) zinc finger protein 37A
dog(488951) zinc finger protein 37A
187 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003421 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003421 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003421 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU066201 MISSION® esiRNA esiRNA human ZNF37A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007094 Rosetta Predictions human pricing
NM_003421 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007094 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183270 predicted 2599
2 SASI_Hs01_00183271 predicted 1092
3 SASI_Hs01_00183272 predicted 1047
4 SASI_Hs01_00183273 predicted 2404
5 SASI_Hs01_00183274 predicted 1487
6 SASI_Hs01_00183275 predicted 1456
7 SASI_Hs01_00183276 predicted 1069
8 SASI_Hs01_00183277 predicted 1268
9 SASI_Hs01_00183278 predicted 1514
10 SASI_Hs01_00183279 predicted 1501
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003421 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040015 predicted 2122
2 SASI_Hs01_00040016 predicted 624
3 SASI_Hs01_00040017 predicted 577
4 SASI_Hs01_00040018 predicted 1927
5 SASI_Hs01_00040019 predicted 1014
6 SASI_Hs01_00040020 predicted 985
7 SASI_Hs01_00040021 predicted 599
8 SASI_Hs01_00040022 predicted 794
9 SASI_Hs01_00040023 predicted 1041
10 SASI_Hs01_00040024 predicted 1030
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003421
ZNF37A MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 37A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003421.1-1774s21c1
Sequence:CCGGCGTCAGAAGTCAGCCCTAATTCTCGAGAATTAGGGCTGACTTCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003421.1-2273s21c1
Sequence:CCGGCCCAATGCCACTCTTCATTAACTCGAGTTAATGAAGAGTGGCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003421.1-571s21c1
Sequence:CCGGCAGAGTCATCTGGAATTAATTCTCGAGAATTAATTCCAGATGACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003421.1-1025s21c1
Sequence:CCGGAGTTAAATCTCACTCCAATTCCTCGAGGAATTGGAGTGAGATTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003421.1-1049s21c1
Sequence:CCGGGAACCCACTCAATTAACAATACTCGAGTATTGTTAATTGAGTGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108200    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003421.1-5023s1c1
Sequence:CCGGGCCAAGTTATTAGTTCCTAAACTCGAGTTTAGGAACTAATAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003421.1-1774s1c1
Sequence:CCGGCGTCAGAAGTCAGCCCTAATTCTCGAGAATTAGGGCTGACTTCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003421.1-627s1c1
Sequence:CCGGTGAGTTTAACAAAGGTGGAAACTCGAGTTTCCACCTTTGTTAAACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003421.1-1049s1c1
Sequence:CCGGGAACCCACTCAATTAACAATACTCGAGTATTGTTAATTGAGTGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003421.1-1436s1c1
Sequence:CCGGTCTCATTTAAGTCAGTCCTTACTCGAGTAAGGACTGACTTAAATGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003421
ZNF37A MISSION shRNA shRNA Plasmid DNA
zinc finger protein 37A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003421.1-1774s21c1
Sequence:CCGGCGTCAGAAGTCAGCCCTAATTCTCGAGAATTAGGGCTGACTTCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003421.1-2273s21c1
Sequence:CCGGCCCAATGCCACTCTTCATTAACTCGAGTTAATGAAGAGTGGCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003421.1-571s21c1
Sequence:CCGGCAGAGTCATCTGGAATTAATTCTCGAGAATTAATTCCAGATGACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003421.1-1025s21c1
Sequence:CCGGAGTTAAATCTCACTCCAATTCCTCGAGGAATTGGAGTGAGATTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003421.1-1049s21c1
Sequence:CCGGGAACCCACTCAATTAACAATACTCGAGTATTGTTAATTGAGTGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108200    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003421.1-5023s1c1
Sequence:CCGGGCCAAGTTATTAGTTCCTAAACTCGAGTTTAGGAACTAATAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003421.1-1774s1c1
Sequence:CCGGCGTCAGAAGTCAGCCCTAATTCTCGAGAATTAGGGCTGACTTCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003421.1-627s1c1
Sequence:CCGGTGAGTTTAACAAAGGTGGAAACTCGAGTTTCCACCTTTGTTAAACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003421.1-1049s1c1
Sequence:CCGGGAACCCACTCAATTAACAATACTCGAGTATTGTTAATTGAGTGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003421.1-1436s1c1
Sequence:CCGGTCTCATTTAAGTCAGTCCTTACTCGAGTAAGGACTGACTTAAATGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003421
ZNF37A MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 37A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003421.1-1774s21c1
Sequence:CCGGCGTCAGAAGTCAGCCCTAATTCTCGAGAATTAGGGCTGACTTCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304170    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003421.1-2273s21c1
Sequence:CCGGCCCAATGCCACTCTTCATTAACTCGAGTTAATGAAGAGTGGCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003421.1-571s21c1
Sequence:CCGGCAGAGTCATCTGGAATTAATTCTCGAGAATTAATTCCAGATGACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003421.1-1025s21c1
Sequence:CCGGAGTTAAATCTCACTCCAATTCCTCGAGGAATTGGAGTGAGATTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003421.1-1049s21c1
Sequence:CCGGGAACCCACTCAATTAACAATACTCGAGTATTGTTAATTGAGTGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108200    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003421.1-5023s1c1
Sequence:CCGGGCCAAGTTATTAGTTCCTAAACTCGAGTTTAGGAACTAATAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003421.1-1774s1c1
Sequence:CCGGCGTCAGAAGTCAGCCCTAATTCTCGAGAATTAGGGCTGACTTCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003421.1-627s1c1
Sequence:CCGGTGAGTTTAACAAAGGTGGAAACTCGAGTTTCCACCTTTGTTAAACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003421.1-1049s1c1
Sequence:CCGGGAACCCACTCAATTAACAATACTCGAGTATTGTTAATTGAGTGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003421.1-1436s1c1
Sequence:CCGGTCTCATTTAAGTCAGTCCTTACTCGAGTAAGGACTGACTTAAATGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks