EMAIL THIS PAGE TO A FRIEND

ZNF382

zinc finger protein 382

Synonyms: KS1
UniProtKB ID: Q96SR6, A3KMP6, A8MT55, C9K0V5, Q53ZY8, Q5JPJ2
Gene ID:
Human(84911) Summary: This gene encodes a KRAB domain zinc finger transcription factor (KZNF). KZNFs play critical roles in the regulation of many cellular processes including differentiation, proliferation and apoptosis. The encoded protein inhibits activating protein 1 (AP-1) and nuclear factor kappa-B (NF-kB) signaling and may function as a tumor suppressor in multiple carcinomas. This gene is found in a cluster with other zinc finger protein genes on the long arm of chromosome 19, and alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
Horse(100060953) zinc finger protein 382
domestic cat(101095783) zinc finger protein 382
dog(484559) zinc finger protein 382
cow(518291) zinc finger protein 382
sheep(101103416) zinc finger protein 382
naked mole-rat(101719433) zinc finger protein 382
Domestic Rabbit(100357785) zinc finger protein 382
domestic guinea pig(100715682) zinc finger protein 382
34 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV39726 Anti-ZNF382 antibody produced in rabbit IgG fraction of antiserum horse, bovine, human, rabbit, mouse, canine, rat
western blot pricing
HPA049259 Anti-ZNF382 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032825 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032825 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032825 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU031621 MISSION® esiRNA esiRNA human ZNF382 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032825 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032825 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127578 predicted 365
2 SASI_Hs01_00127579 predicted 1013
3 SASI_Hs01_00127580 predicted 1005
4 SASI_Hs01_00127581 predicted 1015
5 SASI_Hs01_00127582 predicted 739
6 SASI_Hs01_00127583 predicted 686
7 SASI_Hs01_00127585 predicted 322
8 SASI_Hs01_00127586 predicted 678
9 SASI_Hs01_00127587 predicted 584
10 SASI_Hs02_00360417 predicted 264
11 SASI_Hs01_00127584 predicted 932
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032825
ZNF382 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 382
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032825.2-269s1c1
Sequence:CCGGGCCTGATATGATCCGCAAGTTCTCGAGAACTTGCGGATCATATCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032825.2-651s1c1
Sequence:CCGGGCAGTGAATCTCCATAAACAACTCGAGTTGTTTATGGAGATTCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032825.2-906s1c1
Sequence:CCGGCCCTCTGCCTACAACAAATATCTCGAGATATTTGTTGTAGGCAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032825.2-1688s1c1
Sequence:CCGGGTTCTTCAGTTGTAAGTCAAACTCGAGTTTGACTTACAACTGAAGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032825.2-620s1c1
Sequence:CCGGCCTCAATACCAAGCATGAGAACTCGAGTTCTCATGCTTGGTATTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032825
ZNF382 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 382
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032825.2-269s1c1
Sequence:CCGGGCCTGATATGATCCGCAAGTTCTCGAGAACTTGCGGATCATATCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032825.2-651s1c1
Sequence:CCGGGCAGTGAATCTCCATAAACAACTCGAGTTGTTTATGGAGATTCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032825.2-906s1c1
Sequence:CCGGCCCTCTGCCTACAACAAATATCTCGAGATATTTGTTGTAGGCAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032825.2-1688s1c1
Sequence:CCGGGTTCTTCAGTTGTAAGTCAAACTCGAGTTTGACTTACAACTGAAGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032825.2-620s1c1
Sequence:CCGGCCTCAATACCAAGCATGAGAACTCGAGTTCTCATGCTTGGTATTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032825
ZNF382 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 382
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032825.2-269s1c1
Sequence:CCGGGCCTGATATGATCCGCAAGTTCTCGAGAACTTGCGGATCATATCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032825.2-651s1c1
Sequence:CCGGGCAGTGAATCTCCATAAACAACTCGAGTTGTTTATGGAGATTCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032825.2-906s1c1
Sequence:CCGGCCCTCTGCCTACAACAAATATCTCGAGATATTTGTTGTAGGCAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032825.2-1688s1c1
Sequence:CCGGGTTCTTCAGTTGTAAGTCAAACTCGAGTTTGACTTACAACTGAAGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032825.2-620s1c1
Sequence:CCGGCCTCAATACCAAGCATGAGAACTCGAGTTCTCATGCTTGGTATTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks