EMAIL THIS PAGE TO A FRIEND

ZNF383

zinc finger protein 383

UniProtKB ID: Q8NA42, Q6X2C7
Gene ID:
Domestic Rabbit(100352322) zinc finger protein 383
naked mole-rat(101725470) zinc finger protein 383
cow(539847) zinc finger protein 383
sheep(101122210) zinc finger protein 383
dog(484541) zinc finger protein 383
Horse(100052230) zinc finger protein 383
19 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152604 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152604 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152604 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU055411 MISSION® esiRNA esiRNA human ZNF383 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152604 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152604 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366451 predicted 721
2 SASI_Hs01_00095088 predicted 689
3 SASI_Hs01_00095089 predicted 492
4 SASI_Hs01_00095090 predicted 575
5 SASI_Hs01_00095091 predicted 641
6 SASI_Hs01_00095092 predicted 494
7 SASI_Hs01_00095093 predicted 714
8 SASI_Hs01_00095094 predicted 545
9 SASI_Hs01_00095095 predicted 537
10 SASI_Hs01_00095096 predicted 1118
11 SASI_Hs01_00095097 predicted 560
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152604
VALIDATED
ZNF383 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 383
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152604.1-691s1c1
Sequence:CCGGCCTGAATACATGCCCACATTTCTCGAGAAATGTGGGCATGTATTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_152604.1-1301s1c1
Sequence:CCGGGTAGTGGCTCAGCACTTACTACTCGAGTAGTAAGTGCTGAGCCACTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_152604.1-559s1c1
Sequence:CCGGCAGAGGGAGATAATGGGACTTCTCGAGAAGTCCCATTATCTCCCTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_152604.1-411s1c1
Sequence:CCGGGCCTCAAGTGATCTCCTTATTCTCGAGAATAAGGAGATCACTTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152604.1-412s21c1
Sequence:CCGGCCTCAAGTGATCTCCTTATTGCTCGAGCAATAAGGAGATCACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152604.1-501s21c1
Sequence:CCGGGATGTGTGAAACCAAGTTATTCTCGAGAATAACTTGGTTTCACACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_152604.1-651s21c1
Sequence:CCGGGGGATATCCAAATGGGCATTTCTCGAGAAATGCCCATTTGGATATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_152604.1-725s21c1
Sequence:CCGGTCCTTACTCTCCATCAAATAACTCGAGTTATTTGATGGAGAGTAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_152604.1-553s21c1
Sequence:CCGGTTATGCCAGAGGGAGATAATGCTCGAGCATTATCTCCCTCTGGCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152604
VALIDATED
ZNF383 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 383
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152604.1-691s1c1
Sequence:CCGGCCTGAATACATGCCCACATTTCTCGAGAAATGTGGGCATGTATTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_152604.1-1301s1c1
Sequence:CCGGGTAGTGGCTCAGCACTTACTACTCGAGTAGTAAGTGCTGAGCCACTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_152604.1-559s1c1
Sequence:CCGGCAGAGGGAGATAATGGGACTTCTCGAGAAGTCCCATTATCTCCCTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_152604.1-411s1c1
Sequence:CCGGGCCTCAAGTGATCTCCTTATTCTCGAGAATAAGGAGATCACTTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152604.1-412s21c1
Sequence:CCGGCCTCAAGTGATCTCCTTATTGCTCGAGCAATAAGGAGATCACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152604.1-501s21c1
Sequence:CCGGGATGTGTGAAACCAAGTTATTCTCGAGAATAACTTGGTTTCACACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_152604.1-651s21c1
Sequence:CCGGGGGATATCCAAATGGGCATTTCTCGAGAAATGCCCATTTGGATATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_152604.1-725s21c1
Sequence:CCGGTCCTTACTCTCCATCAAATAACTCGAGTTATTTGATGGAGAGTAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_152604.1-553s21c1
Sequence:CCGGTTATGCCAGAGGGAGATAATGCTCGAGCATTATCTCCCTCTGGCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152604
VALIDATED
ZNF383 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 383
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152604.1-691s1c1
Sequence:CCGGCCTGAATACATGCCCACATTTCTCGAGAAATGTGGGCATGTATTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_152604.1-1301s1c1
Sequence:CCGGGTAGTGGCTCAGCACTTACTACTCGAGTAGTAAGTGCTGAGCCACTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_152604.1-559s1c1
Sequence:CCGGCAGAGGGAGATAATGGGACTTCTCGAGAAGTCCCATTATCTCCCTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_152604.1-411s1c1
Sequence:CCGGGCCTCAAGTGATCTCCTTATTCTCGAGAATAAGGAGATCACTTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152604.1-412s21c1
Sequence:CCGGCCTCAAGTGATCTCCTTATTGCTCGAGCAATAAGGAGATCACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152604.1-501s21c1
Sequence:CCGGGATGTGTGAAACCAAGTTATTCTCGAGAATAACTTGGTTTCACACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_152604.1-651s21c1
Sequence:CCGGGGGATATCCAAATGGGCATTTCTCGAGAAATGCCCATTTGGATATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_152604.1-725s21c1
Sequence:CCGGTCCTTACTCTCCATCAAATAACTCGAGTTATTTGATGGAGAGTAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_152604.1-553s21c1
Sequence:CCGGTTATGCCAGAGGGAGATAATGCTCGAGCATTATCTCCCTCTGGCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks