EMAIL THIS PAGE TO A FRIEND

ZNF384

zinc finger protein 384

Synonyms: CAGH1 CAGH1A CIZ ERDA2 NMP4 NP TNRC1
UniProtKB ID: Q8TF68, O15407, Q7Z722, Q8N938
Gene ID:
Human(171017) Summary: This gene encodes a C2H2-type zinc finger protein, which may function as a transcription factor. This gene also contains long CAG trinucleotide repeats that encode consecutive glutamine residues. The protein appears to bind and regulate the promoters of the extracellular matrix genes MMP1, MMP3, MMP7 and COL1A1. Studies in mouse suggest that nuclear matrix transcription factors (NP/NMP4) may be part of a general mechanical pathway that couples cell construction and function during extracellular matrix remodeling. Alternative splicing results in multiple transcript variants. Recurrent rearrangements of this gene with the Ewing's sarcoma gene, EWSR1 on chromosome 22, or with the TAF15 gene on chromosome 17, or with the TCF3 (E2A) gene on chromosome 19, have been observed in acute leukemia. A related pseudogene has been identified on chromosome 7. [provided by RefSeq, Apr 2011]
chicken(770350) zinc finger protein 384
dog(486723) zinc finger protein 384
Horse(100059879) zinc finger protein 384
domestic cat(101083184) zinc finger protein 384
cow(515007) zinc finger protein 384
sheep(101111704) zinc finger protein 384
naked mole-rat(101711787) zinc finger protein 384
domestic guinea pig(100726713) zinc finger protein 384
137 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133476 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133476 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133476 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039916 Rosetta Predictions human pricing
NM_001039917 Rosetta Predictions human pricing
NM_001039918 Rosetta Predictions human pricing
NM_001039919 Rosetta Predictions human pricing
NM_001039920 Rosetta Predictions human pricing
NM_133476 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039916 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308717 predicted 1335
2 SASI_Hs01_00093229 predicted 2465
3 SASI_Hs01_00093230 predicted 1189
4 SASI_Hs01_00093231 predicted 2369
5 SASI_Hs01_00093232 predicted 1198
6 SASI_Hs01_00093233 predicted 2230
7 SASI_Hs01_00093234 predicted 2083
8 SASI_Hs01_00093235 predicted 2076
9 SASI_Hs01_00093236 predicted 1459
10 SASI_Hs01_00093237 predicted 2357
11 SASI_Hs01_00093228 predicted 2483
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039917 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308718 predicted 1041
2 SASI_Hs01_00200127 predicted 2173
3 SASI_Hs01_00200128 predicted 887
4 SASI_Hs01_00200129 predicted 2064
5 SASI_Hs01_00200130 predicted 900
6 SASI_Hs01_00200131 predicted 1932
7 SASI_Hs01_00200132 predicted 1779
8 SASI_Hs01_00200133 predicted 1779
9 SASI_Hs01_00200134 predicted 1163
10 SASI_Hs01_00200135 predicted 2055
11 SASI_Hs01_00200126 predicted 2185
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039918 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308719 predicted 1120
2 SASI_Hs01_00231923 predicted 2251
3 SASI_Hs01_00231924 predicted 970
4 SASI_Hs01_00231925 predicted 2147
5 SASI_Hs01_00231926 predicted 979
6 SASI_Hs01_00231927 predicted 2013
7 SASI_Hs01_00231928 predicted 1862
8 SASI_Hs01_00231929 predicted 1855
9 SASI_Hs01_00231930 predicted 1244
10 SASI_Hs01_00231931 predicted 2138
11 SASI_Hs01_00231922 predicted 2270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039919 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308720 predicted 992
2 SASI_Hs01_00095189 predicted 2119
3 SASI_Hs01_00095190 predicted 839
4 SASI_Hs01_00095191 predicted 2022
5 SASI_Hs01_00095192 predicted 849
6 SASI_Hs01_00095193 predicted 1891
7 SASI_Hs01_00095194 predicted 1736
8 SASI_Hs01_00095195 predicted 1735
9 SASI_Hs01_00095196 predicted 1111
10 SASI_Hs01_00095197 predicted 2010
11 SASI_Hs01_00095188 predicted 2145
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039920 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308721 predicted 879
2 SASI_Hs01_00159604 predicted 2005
3 SASI_Hs01_00159605 predicted 726
4 SASI_Hs01_00159606 predicted 1905
5 SASI_Hs01_00159607 predicted 734
6 SASI_Hs01_00159608 predicted 1769
7 SASI_Hs01_00159609 predicted 1622
8 SASI_Hs01_00159610 predicted 1611
9 SASI_Hs01_00159611 predicted 995
10 SASI_Hs01_00159612 predicted 1886
11 SASI_Hs01_00159603 predicted 2025
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133476 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363198 predicted 1170
2 SASI_Hs01_00083118 predicted 2298
3 SASI_Hs01_00083119 predicted 1014
4 SASI_Hs01_00083120 predicted 2197
5 SASI_Hs01_00083121 predicted 1029
6 SASI_Hs01_00083122 predicted 2063
7 SASI_Hs01_00083123 predicted 1911
8 SASI_Hs01_00083124 predicted 1903
9 SASI_Hs01_00083125 predicted 1289
10 SASI_Hs01_00083126 predicted 2186
11 SASI_Hs01_00083117 predicted 2321
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133476
VALIDATED
ZNF384 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 384
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_133476.3-942s21c1
Sequence:CCGGCCCGAGATGAATGACCCTTATCTCGAGATAAGGGTCATTCATCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_133476.3-1293s21c1
Sequence:CCGGGCCTTCACACAACTCTCCAATCTCGAGATTGGAGAGTTGTGTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133476.3-395s21c1
Sequence:CCGGGATCGAGAACACAATGTTCATCTCGAGATGAACATTGTGTTCTCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_133476.3-1329s21c1
Sequence:CCGGCGGCAACACAACAAAGATAAACTCGAGTTTATCTTTGTTGTGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_133476.3-762s21c1
Sequence:CCGGCCCATGATTGTCTCAGCTCTTCTCGAGAAGAGCTGAGACAATCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_133476.2-1292s1c1
Sequence:CCGGCGGCAACACAACAAAGATAAACTCGAGTTTATCTTTGTTGTGTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_133476.2-1256s1c1
Sequence:CCGGGCCTTCACACAACTCTCCAATCTCGAGATTGGAGAGTTGTGTGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_133476.2-358s1c1
Sequence:CCGGGATCGAGAACACAATGTTCATCTCGAGATGAACATTGTGTTCTCGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_133476.2-905s1c1
Sequence:CCGGCCCGAGATGAATGACCCTTATCTCGAGATAAGGGTCATTCATCTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133476
VALIDATED
ZNF384 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 384
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_133476.3-942s21c1
Sequence:CCGGCCCGAGATGAATGACCCTTATCTCGAGATAAGGGTCATTCATCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_133476.3-1293s21c1
Sequence:CCGGGCCTTCACACAACTCTCCAATCTCGAGATTGGAGAGTTGTGTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133476.3-395s21c1
Sequence:CCGGGATCGAGAACACAATGTTCATCTCGAGATGAACATTGTGTTCTCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_133476.3-1329s21c1
Sequence:CCGGCGGCAACACAACAAAGATAAACTCGAGTTTATCTTTGTTGTGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_133476.3-762s21c1
Sequence:CCGGCCCATGATTGTCTCAGCTCTTCTCGAGAAGAGCTGAGACAATCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_133476.2-1292s1c1
Sequence:CCGGCGGCAACACAACAAAGATAAACTCGAGTTTATCTTTGTTGTGTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_133476.2-1256s1c1
Sequence:CCGGGCCTTCACACAACTCTCCAATCTCGAGATTGGAGAGTTGTGTGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_133476.2-358s1c1
Sequence:CCGGGATCGAGAACACAATGTTCATCTCGAGATGAACATTGTGTTCTCGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_133476.2-905s1c1
Sequence:CCGGCCCGAGATGAATGACCCTTATCTCGAGATAAGGGTCATTCATCTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133476
VALIDATED
ZNF384 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 384
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_133476.3-942s21c1
Sequence:CCGGCCCGAGATGAATGACCCTTATCTCGAGATAAGGGTCATTCATCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_133476.3-1293s21c1
Sequence:CCGGGCCTTCACACAACTCTCCAATCTCGAGATTGGAGAGTTGTGTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133476.3-395s21c1
Sequence:CCGGGATCGAGAACACAATGTTCATCTCGAGATGAACATTGTGTTCTCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_133476.3-1329s21c1
Sequence:CCGGCGGCAACACAACAAAGATAAACTCGAGTTTATCTTTGTTGTGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_133476.3-762s21c1
Sequence:CCGGCCCATGATTGTCTCAGCTCTTCTCGAGAAGAGCTGAGACAATCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_133476.2-1292s1c1
Sequence:CCGGCGGCAACACAACAAAGATAAACTCGAGTTTATCTTTGTTGTGTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_133476.2-1256s1c1
Sequence:CCGGGCCTTCACACAACTCTCCAATCTCGAGATTGGAGAGTTGTGTGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_133476.2-358s1c1
Sequence:CCGGGATCGAGAACACAATGTTCATCTCGAGATGAACATTGTGTTCTCGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_133476.2-905s1c1
Sequence:CCGGCCCGAGATGAATGACCCTTATCTCGAGATAAGGGTCATTCATCTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks