EMAIL THIS PAGE TO A FRIEND

ZNF385A

zinc finger protein 385A

Synonyms: HZF RZF ZFP385 ZNF385
Gene ID:
Human(25946) Summary: Zinc finger proteins, such as ZNF385A, are regulatory proteins that act as transcription factors, bind single- or double-stranded RNA, or interact with other proteins (Sharma et al., 2004 [PubMed 15527981]
Zebrafish(336030) zinc finger protein 385A
domestic cat(101093447) zinc finger protein 385A
dog(477591) zinc finger protein 385A
domestic guinea pig(100726225) zinc finger protein 385A
naked mole-rat(101713358) zinc finger protein 385A
cow(540045) zinc finger protein 385A
sheep(101107591) zinc finger protein 385A
124 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015481 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015481 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015481 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU117041 MISSION® esiRNA esiRNA human ZNF385A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015481 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015481 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027346 predicted 929
2 SASI_Hs01_00027347 predicted 328
3 SASI_Hs01_00027348 predicted 999
4 SASI_Hs01_00027349 predicted 782
5 SASI_Hs01_00027350 predicted 283
6 SASI_Hs01_00027351 predicted 349
7 SASI_Hs01_00027352 predicted 628
8 SASI_Hs01_00027353 predicted 342
9 SASI_Hs01_00027354 predicted 771
10 SASI_Hs02_00347924 predicted 310
11 SASI_Hs01_00027355 predicted 820
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015481
VALIDATED
ZNF385A MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 385A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_015481.1-396s1c1
Sequence:CCGGGCACTACAAAGGTAATCGCCACTCGAGTGGCGATTACCTTTGTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_015481.1-765s1c1
Sequence:CCGGCCAGCTTGAGGCACATAACAACTCGAGTTGTTATGTGCCTCAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015481.1-772s1c1
Sequence:CCGGGAGGCACATAACAAAGGTACTCTCGAGAGTACCTTTGTTATGTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015481.1-350s1c1
Sequence:CCGGGTAATATCTGTCAAATCCGCTCTCGAGAGCGGATTTGACAGATATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015481.1-775s1c1
Sequence:CCGGGCACATAACAAAGGTACTAAGCTCGAGCTTAGTACCTTTGTTATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136774    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_015481.1-1372s1c1
Sequence:CCGGCTCCCTAAATGATCTCTCCTTCTCGAGAAGGAGAGATCATTTAGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015481.1-915s1c1
Sequence:CCGGGATCTGCAATGTCAAGGTCAACTCGAGTTGACCTTGACATTGCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_015481.1-336s1c1
Sequence:CCGGGCCCGTCATTTCCTGTAATATCTCGAGATATTACAGGAAATGACGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137778    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_015481.1-2232s1c1
Sequence:CCGGGTTTCCGTATCGTCAACCCTTCTCGAGAAGGGTTGACGATACGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015481.1-252s1c1
Sequence:CCGGCTTCAGCAACTACAGCACCATCTCGAGATGGTGCTGTAGTTGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015481
VALIDATED
ZNF385A MISSION shRNA shRNA Plasmid DNA
zinc finger protein 385A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_015481.1-396s1c1
Sequence:CCGGGCACTACAAAGGTAATCGCCACTCGAGTGGCGATTACCTTTGTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_015481.1-765s1c1
Sequence:CCGGCCAGCTTGAGGCACATAACAACTCGAGTTGTTATGTGCCTCAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015481.1-772s1c1
Sequence:CCGGGAGGCACATAACAAAGGTACTCTCGAGAGTACCTTTGTTATGTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015481.1-350s1c1
Sequence:CCGGGTAATATCTGTCAAATCCGCTCTCGAGAGCGGATTTGACAGATATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015481.1-775s1c1
Sequence:CCGGGCACATAACAAAGGTACTAAGCTCGAGCTTAGTACCTTTGTTATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136774    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_015481.1-1372s1c1
Sequence:CCGGCTCCCTAAATGATCTCTCCTTCTCGAGAAGGAGAGATCATTTAGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015481.1-915s1c1
Sequence:CCGGGATCTGCAATGTCAAGGTCAACTCGAGTTGACCTTGACATTGCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_015481.1-336s1c1
Sequence:CCGGGCCCGTCATTTCCTGTAATATCTCGAGATATTACAGGAAATGACGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137778    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_015481.1-2232s1c1
Sequence:CCGGGTTTCCGTATCGTCAACCCTTCTCGAGAAGGGTTGACGATACGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015481.1-252s1c1
Sequence:CCGGCTTCAGCAACTACAGCACCATCTCGAGATGGTGCTGTAGTTGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015481
VALIDATED
ZNF385A MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 385A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_015481.1-396s1c1
Sequence:CCGGGCACTACAAAGGTAATCGCCACTCGAGTGGCGATTACCTTTGTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_015481.1-765s1c1
Sequence:CCGGCCAGCTTGAGGCACATAACAACTCGAGTTGTTATGTGCCTCAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015481.1-772s1c1
Sequence:CCGGGAGGCACATAACAAAGGTACTCTCGAGAGTACCTTTGTTATGTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015481.1-350s1c1
Sequence:CCGGGTAATATCTGTCAAATCCGCTCTCGAGAGCGGATTTGACAGATATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015481.1-775s1c1
Sequence:CCGGGCACATAACAAAGGTACTAAGCTCGAGCTTAGTACCTTTGTTATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136774    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_015481.1-1372s1c1
Sequence:CCGGCTCCCTAAATGATCTCTCCTTCTCGAGAAGGAGAGATCATTTAGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015481.1-915s1c1
Sequence:CCGGGATCTGCAATGTCAAGGTCAACTCGAGTTGACCTTGACATTGCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_015481.1-336s1c1
Sequence:CCGGGCCCGTCATTTCCTGTAATATCTCGAGATATTACAGGAAATGACGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137778    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_015481.1-2232s1c1
Sequence:CCGGGTTTCCGTATCGTCAACCCTTCTCGAGAAGGGTTGACGATACGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015481.1-252s1c1
Sequence:CCGGCTTCAGCAACTACAGCACCATCTCGAGATGGTGCTGTAGTTGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks