EMAIL THIS PAGE TO A FRIEND

ZNF385B

zinc finger protein 385B

Synonyms: ZFN533 ZNF533
UniProtKB ID: Q569K4, Q49A04, Q6ZMZ7, Q8IY01, Q8N8H2, Q96DK4
Gene ID:
cow(613328) zinc finger protein 385B
sheep(101121828) zinc finger protein 385B
naked mole-rat(101705769) zinc finger protein 385B
domestic guinea pig(100720829) zinc finger protein 385B
Zebrafish(368405) zinc finger protein 385B
Horse(100053893) zinc finger protein 385B
domestic cat(101095843) zinc finger protein 385B
dog(488426) zinc finger protein 385B
chicken(424124) zinc finger protein 385B
106 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152520 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152520 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152520 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU134791 MISSION® esiRNA esiRNA human ZNF385B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001113397 Rosetta Predictions human pricing
NM_001113398 Rosetta Predictions human pricing
NM_152520 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113397 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325791 predicted 884
2 SASI_Hs02_00325792 predicted 974
3 SASI_Hs02_00325793 predicted 1256
4 SASI_Hs02_00325794 predicted 1539
5 SASI_Hs02_00325795 predicted 602
6 SASI_Hs02_00325796 predicted 1473
7 SASI_Hs02_00325797 predicted 1100
8 SASI_Hs02_00325798 predicted 1188
9 SASI_Hs02_00325799 predicted 1541
10 SASI_Hs02_00325800 predicted 1555
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113398 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325801 predicted 747
2 SASI_Hs02_00325802 predicted 835
3 SASI_Hs02_00325803 predicted 1120
4 SASI_Hs02_00325804 predicted 1406
5 SASI_Hs02_00325805 predicted 459
6 SASI_Hs02_00325806 predicted 1328
7 SASI_Hs02_00325807 predicted 957
8 SASI_Hs02_00325808 predicted 1040
9 SASI_Hs02_00325809 predicted 1405
10 SASI_Hs02_00325810 predicted 1410
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152520 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216703 predicted 1413
2 SASI_Hs01_00216704 predicted 1507
3 SASI_Hs01_00216705 predicted 1778
4 SASI_Hs01_00216709 predicted 2067
5 SASI_Hs02_00366310 predicted 1130
6 SASI_Hs02_00366311 predicted 1992
7 SASI_Hs02_00366312 predicted 1629
8 SASI_Hs02_00366313 predicted 1708
9 SASI_Hs02_00366314 predicted 2070
10 SASI_Hs02_00366315 predicted 2080
11 SASI_Hs01_00216706 predicted 1642
12 SASI_Hs01_00216707 predicted 1491
13 SASI_Hs01_00216708 predicted 695
14 SASI_Hs01_00216710 predicted 859
15 SASI_Hs01_00216711 predicted 765
16 SASI_Hs01_00216712 predicted 618
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152520
ZNF385B MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 385B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116202    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152520.3-1993s1c1
Sequence:CCGGCCAGAGAGAAACACATCACTACTCGAGTAGTGATGTGTTTCTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152520.3-1621s1c1
Sequence:CCGGCCCGAGTATTCTAGCAGCAAACTCGAGTTTGCTGCTAGAATACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152520.3-1394s1c1
Sequence:CCGGGCTGGTCCAATTAAATCCTATCTCGAGATAGGATTTAATTGGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152520.3-959s1c1
Sequence:CCGGGCCCACTACAAAGGAAGTAAACTCGAGTTTACTTCCTTTGTAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152520.3-854s1c1
Sequence:CCGGGCGGTTATTAACCATACATTTCTCGAGAAATGTATGGTTAATAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152520
ZNF385B MISSION shRNA shRNA Plasmid DNA
zinc finger protein 385B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116202    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152520.3-1993s1c1
Sequence:CCGGCCAGAGAGAAACACATCACTACTCGAGTAGTGATGTGTTTCTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152520.3-1621s1c1
Sequence:CCGGCCCGAGTATTCTAGCAGCAAACTCGAGTTTGCTGCTAGAATACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152520.3-1394s1c1
Sequence:CCGGGCTGGTCCAATTAAATCCTATCTCGAGATAGGATTTAATTGGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152520.3-959s1c1
Sequence:CCGGGCCCACTACAAAGGAAGTAAACTCGAGTTTACTTCCTTTGTAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152520.3-854s1c1
Sequence:CCGGGCGGTTATTAACCATACATTTCTCGAGAAATGTATGGTTAATAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152520
ZNF385B MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 385B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116202    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152520.3-1993s1c1
Sequence:CCGGCCAGAGAGAAACACATCACTACTCGAGTAGTGATGTGTTTCTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152520.3-1621s1c1
Sequence:CCGGCCCGAGTATTCTAGCAGCAAACTCGAGTTTGCTGCTAGAATACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152520.3-1394s1c1
Sequence:CCGGGCTGGTCCAATTAAATCCTATCTCGAGATAGGATTTAATTGGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152520.3-959s1c1
Sequence:CCGGGCCCACTACAAAGGAAGTAAACTCGAGTTTACTTCCTTTGTAGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152520.3-854s1c1
Sequence:CCGGGCGGTTATTAACCATACATTTCTCGAGAAATGTATGGTTAATAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks