EMAIL THIS PAGE TO A FRIEND

ZNF385C

zinc finger protein 385C

UniProtKB ID: Q66K41, Q4G0J1
Gene ID:
Zebrafish(793202) zinc finger protein 385C
dog(490972) uncharacterized LOC490972
chicken(420031) zinc finger protein 385C
domestic guinea pig(100716248) zinc finger protein 385C
naked mole-rat(101698304) zinc finger protein 385C
cow(100298918) zinc finger protein 385C
12 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013624 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013624 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013624 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU149481 MISSION® esiRNA esiRNA human ZNF385C (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013624 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013624 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044120 predicted 786
2 SASI_Hs01_00044121 predicted 687
3 SASI_Hs01_00044122 predicted 206
4 SASI_Hs01_00044123 predicted 933
5 SASI_Hs01_00044124 predicted 856
6 SASI_Hs01_00044125 predicted 1021
7 SASI_Hs01_00044126 predicted 412
8 SASI_Hs01_00044127 predicted 937
9 SASI_Hs01_00044128 predicted 719
10 SASI_Hs01_00044129 predicted 1101
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013624
ZNF385C MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 385C
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148018    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013624.1-417s1c1
Sequence:CCGGGTGAGTATCCTCAAGTCTAAACTCGAGTTTAGACTTGAGGATACTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013624.1-419s1c1
Sequence:CCGGGAGTATCCTCAAGTCTAAACTCTCGAGAGTTTAGACTTGAGGATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181154    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013624.1-291s1c1
Sequence:CCGGCAGGTCAATTCAGAGACCCAACTCGAGTTGGGTCTCTGAATTGACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180994    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013624.1-682s1c1
Sequence:CCGGGCCAGAGCTGATTTCCCAATACTCGAGTATTGGGAAATCAGCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013624.1-449s1c1
Sequence:CCGGGAAGCAACTCACCAAGACGTTCTCGAGAACGTCTTGGTGAGTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013624.1-414s1c1
Sequence:CCGGGCTGTGAGTATCCTCAAGTCTCTCGAGAGACTTGAGGATACTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013624
ZNF385C MISSION shRNA shRNA Plasmid DNA
zinc finger protein 385C
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148018    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013624.1-417s1c1
Sequence:CCGGGTGAGTATCCTCAAGTCTAAACTCGAGTTTAGACTTGAGGATACTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013624.1-419s1c1
Sequence:CCGGGAGTATCCTCAAGTCTAAACTCTCGAGAGTTTAGACTTGAGGATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181154    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013624.1-291s1c1
Sequence:CCGGCAGGTCAATTCAGAGACCCAACTCGAGTTGGGTCTCTGAATTGACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180994    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013624.1-682s1c1
Sequence:CCGGGCCAGAGCTGATTTCCCAATACTCGAGTATTGGGAAATCAGCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013624.1-449s1c1
Sequence:CCGGGAAGCAACTCACCAAGACGTTCTCGAGAACGTCTTGGTGAGTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013624.1-414s1c1
Sequence:CCGGGCTGTGAGTATCCTCAAGTCTCTCGAGAGACTTGAGGATACTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013624
ZNF385C MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 385C
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148018    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013624.1-417s1c1
Sequence:CCGGGTGAGTATCCTCAAGTCTAAACTCGAGTTTAGACTTGAGGATACTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013624.1-419s1c1
Sequence:CCGGGAGTATCCTCAAGTCTAAACTCTCGAGAGTTTAGACTTGAGGATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181154    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013624.1-291s1c1
Sequence:CCGGCAGGTCAATTCAGAGACCCAACTCGAGTTGGGTCTCTGAATTGACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180994    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013624.1-682s1c1
Sequence:CCGGGCCAGAGCTGATTTCCCAATACTCGAGTATTGGGAAATCAGCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013624.1-449s1c1
Sequence:CCGGGAAGCAACTCACCAAGACGTTCTCGAGAACGTCTTGGTGAGTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013624.1-414s1c1
Sequence:CCGGGCTGTGAGTATCCTCAAGTCTCTCGAGAGACTTGAGGATACTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks