EMAIL THIS PAGE TO A FRIEND

ZNF385D

zinc finger protein 385D

Synonyms: ZNF659
UniProtKB ID: Q9H6B1
Gene ID:
cow(789528) zinc finger protein 385D
sheep(101104040) zinc finger protein 385D
naked mole-rat(101699906) zinc finger protein 385D
domestic guinea pig(100717336) zinc finger protein 385D
chicken(420651) zinc finger protein 385D
domestic cat(101082258) zinc finger protein 385D
Horse(100051873) zinc finger protein 385D
dog(477051) zinc finger protein 385D
19 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024697 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024697 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024697 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU037131 MISSION® esiRNA esiRNA human ZNF659 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024697 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024697 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214308 predicted 1007
2 SASI_Hs01_00214309 predicted 487
3 SASI_Hs01_00214310 predicted 1156
4 SASI_Hs02_00357153 predicted 1010
5 SASI_Hs01_00214311 predicted 960
6 SASI_Hs01_00214312 predicted 1098
7 SASI_Hs01_00214313 predicted 883
8 SASI_Hs01_00214314 predicted 751
9 SASI_Hs01_00214315 predicted 642
10 SASI_Hs01_00214316 predicted 1021
11 SASI_Hs01_00214317 predicted 654
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024697
ZNF385D MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 385D
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024697.1-705s1c1
Sequence:CCGGCAAAGGCACGAAACATGCCAACTCGAGTTGGCATGTTTCGTGCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024697.1-759s1c1
Sequence:CCGGGCAGAAATCTGTAACTGCCAACTCGAGTTGGCAGTTACAGATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024697.1-1113s1c1
Sequence:CCGGGAATGGAAGTGGCACTATCAACTCGAGTTGATAGTGCCACTTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024697.1-485s1c1
Sequence:CCGGCTTTGCAACCATCGCTGGATACTCGAGTATCCAGCGATGGTTGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024697.1-1074s1c1
Sequence:CCGGCAACAGTGGTACTAAGCACAACTCGAGTTGTGCTTAGTACCACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024697.1-965s1c1
Sequence:CCGGGCAATAGCTCATGTCCTTCTACTCGAGTAGAAGGACATGAGCTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024697.2-1238s21c1
Sequence:CCGGACTCGGAAACGCAACTTAAACCTCGAGGTTTAAGTTGCGTTTCCGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024697.2-629s21c1
Sequence:CCGGACCGAAGAAAGCAAATCATATCTCGAGATATGATTTGCTTTCTTCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024697.2-581s21c1
Sequence:CCGGCGATTCAGAAAGCTGTAATAACTCGAGTTATTACAGCTTTCTGAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024697.2-1608s21c1
Sequence:CCGGGAGTAATTGTACTGCAATAATCTCGAGATTATTGCAGTACAATTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024697
ZNF385D MISSION shRNA shRNA Plasmid DNA
zinc finger protein 385D
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024697.1-705s1c1
Sequence:CCGGCAAAGGCACGAAACATGCCAACTCGAGTTGGCATGTTTCGTGCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024697.1-759s1c1
Sequence:CCGGGCAGAAATCTGTAACTGCCAACTCGAGTTGGCAGTTACAGATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024697.1-1113s1c1
Sequence:CCGGGAATGGAAGTGGCACTATCAACTCGAGTTGATAGTGCCACTTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024697.1-485s1c1
Sequence:CCGGCTTTGCAACCATCGCTGGATACTCGAGTATCCAGCGATGGTTGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024697.1-1074s1c1
Sequence:CCGGCAACAGTGGTACTAAGCACAACTCGAGTTGTGCTTAGTACCACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024697.1-965s1c1
Sequence:CCGGGCAATAGCTCATGTCCTTCTACTCGAGTAGAAGGACATGAGCTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024697.2-1238s21c1
Sequence:CCGGACTCGGAAACGCAACTTAAACCTCGAGGTTTAAGTTGCGTTTCCGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024697.2-629s21c1
Sequence:CCGGACCGAAGAAAGCAAATCATATCTCGAGATATGATTTGCTTTCTTCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024697.2-581s21c1
Sequence:CCGGCGATTCAGAAAGCTGTAATAACTCGAGTTATTACAGCTTTCTGAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024697.2-1608s21c1
Sequence:CCGGGAGTAATTGTACTGCAATAATCTCGAGATTATTGCAGTACAATTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024697
ZNF385D MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 385D
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024697.1-705s1c1
Sequence:CCGGCAAAGGCACGAAACATGCCAACTCGAGTTGGCATGTTTCGTGCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024697.1-759s1c1
Sequence:CCGGGCAGAAATCTGTAACTGCCAACTCGAGTTGGCAGTTACAGATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024697.1-1113s1c1
Sequence:CCGGGAATGGAAGTGGCACTATCAACTCGAGTTGATAGTGCCACTTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024697.1-485s1c1
Sequence:CCGGCTTTGCAACCATCGCTGGATACTCGAGTATCCAGCGATGGTTGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024697.1-1074s1c1
Sequence:CCGGCAACAGTGGTACTAAGCACAACTCGAGTTGTGCTTAGTACCACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024697.1-965s1c1
Sequence:CCGGGCAATAGCTCATGTCCTTCTACTCGAGTAGAAGGACATGAGCTATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024697.2-1238s21c1
Sequence:CCGGACTCGGAAACGCAACTTAAACCTCGAGGTTTAAGTTGCGTTTCCGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024697.2-629s21c1
Sequence:CCGGACCGAAGAAAGCAAATCATATCTCGAGATATGATTTGCTTTCTTCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024697.2-581s21c1
Sequence:CCGGCGATTCAGAAAGCTGTAATAACTCGAGTTATTACAGCTTTCTGAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024697.2-1608s21c1
Sequence:CCGGGAGTAATTGTACTGCAATAATCTCGAGATTATTGCAGTACAATTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks