EMAIL THIS PAGE TO A FRIEND

ZNF391

zinc finger protein 391

Synonyms: dJ153G14.3
UniProtKB ID: Q9UJN7, B4DH77
Gene ID:
cow(513014) zinc finger protein 391
sheep(101121211) zinc finger protein 391
domestic cat(101081630) zinc finger protein 391
Horse(100053230) zinc finger protein 391
dog(488295) zinc finger protein 391
29 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001076781 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001076781 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001076781 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001076781 Rosetta Predictions human pricing
XM_294077 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001076781 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312034 predicted 1162
2 SASI_Hs02_00312035 predicted 1131
3 SASI_Hs02_00312036 predicted 706
4 SASI_Hs02_00312037 predicted 1124
5 SASI_Hs02_00312038 predicted 883
6 SASI_Hs02_00312039 predicted 896
7 SASI_Hs02_00312040 predicted 1222
8 SASI_Hs02_00312041 predicted 555
9 SASI_Hs02_00312042 predicted 882
10 SASI_Hs02_00312043 predicted 793
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_294077 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00300024 predicted 761
2 SASI_Hs01_00300025 predicted 721
3 SASI_Hs01_00300026 predicted 461
4 SASI_Hs01_00300027 predicted 440
5 SASI_Hs01_00300028 predicted 721
6 SASI_Hs01_00300029 predicted 555
7 SASI_Hs01_00300030 predicted 650
8 SASI_Hs01_00300031 predicted 812
9 SASI_Hs01_00300032 predicted 693
10 SASI_Hs01_00300033 predicted 544
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001076781
ZNF391 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 391
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076781.1-701s21c1
Sequence:CCGGATCCAGTGAATTTAGTCTAAGCTCGAGCTTAGACTAAATTCACTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076781.1-583s21c1
Sequence:GTACCGGGCCAATTATCAAGGCAAACAACTCGAGTTGTTTGCCTTGATAATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076781.1-1209s21c1
Sequence:CCGGGGTGACCGTTCAACCATAATTCTCGAGAATTATGGTTGAACGGTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076781.1-957s21c1
Sequence:CCGGAGCCGAAGTACACACCTTATTCTCGAGAATAAGGTGTGTACTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076781.1-1040s21c1
Sequence:CCGGTAGCCGGAGCACACATCTTAGCTCGAGCTAAGATGTGTGCTCCGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001076781
ZNF391 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 391
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076781.1-701s21c1
Sequence:CCGGATCCAGTGAATTTAGTCTAAGCTCGAGCTTAGACTAAATTCACTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076781.1-583s21c1
Sequence:GTACCGGGCCAATTATCAAGGCAAACAACTCGAGTTGTTTGCCTTGATAATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076781.1-1209s21c1
Sequence:CCGGGGTGACCGTTCAACCATAATTCTCGAGAATTATGGTTGAACGGTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076781.1-957s21c1
Sequence:CCGGAGCCGAAGTACACACCTTATTCTCGAGAATAAGGTGTGTACTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076781.1-1040s21c1
Sequence:CCGGTAGCCGGAGCACACATCTTAGCTCGAGCTAAGATGTGTGCTCCGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001076781
ZNF391 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 391
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076781.1-701s21c1
Sequence:CCGGATCCAGTGAATTTAGTCTAAGCTCGAGCTTAGACTAAATTCACTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076781.1-583s21c1
Sequence:GTACCGGGCCAATTATCAAGGCAAACAACTCGAGTTGTTTGCCTTGATAATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076781.1-1209s21c1
Sequence:CCGGGGTGACCGTTCAACCATAATTCTCGAGAATTATGGTTGAACGGTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076781.1-957s21c1
Sequence:CCGGAGCCGAAGTACACACCTTATTCTCGAGAATAAGGTGTGTACTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001076781.1-1040s21c1
Sequence:CCGGTAGCCGGAGCACACATCTTAGCTCGAGCTAAGATGTGTGCTCCGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks