EMAIL THIS PAGE TO A FRIEND

ZNF394

zinc finger protein 394

Synonyms: ZKSCAN14 ZSCAN46
UniProtKB ID: Q53GI3, A4D281, Q6P5X9, Q8TB27, Q9HA37, Q9UD51
Gene ID:
dog(479741) zinc finger protein 394
Horse(100067758) zinc finger protein 394
domestic cat(101096435) zinc finger protein 394
cow(522836) zinc finger protein 394
sheep(101112444) zinc finger protein 394
domestic guinea pig(100713561) zinc finger protein 394
naked mole-rat(101696571) zinc finger protein 394
27 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032164 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032164 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032164 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032164 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032164 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161659 predicted 1506
2 SASI_Hs02_00359404 predicted 337
3 SASI_Hs01_00161660 predicted 970
4 SASI_Hs01_00161661 predicted 1439
5 SASI_Hs01_00161662 predicted 1459
6 SASI_Hs01_00161663 predicted 1236
7 SASI_Hs01_00161664 predicted 947
8 SASI_Hs01_00161666 predicted 709
9 SASI_Hs01_00161668 predicted 291
10 SASI_Hs02_00359405 predicted 768
11 SASI_Hs01_00161665 predicted 1120
12 SASI_Hs01_00161667 predicted 1536
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032164
VALIDATED
ZNF394 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 394
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_032164.2-773s21c1
Sequence:CCGGGTTGATTCCAATGCAACAAATCTCGAGATTTGTTGCATTGGAATCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032164.2-1217s21c1
Sequence:CCGGCCATGAAGAAAGACCTTATAACTCGAGTTATAAGGTCTTTCTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_032164.2-1265s21c1
Sequence:CCGGACAACGCTCTGACCTCTTTAGCTCGAGCTAAAGAGGTCAGAGCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032164.2-957s21c1
Sequence:GTACCGGAGCATCTCAGATGTCAATAAGCTCGAGCTTATTGACATCTGAGATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_032164.2-1598s21c1
Sequence:CCGGACAGCGCTCTGACCTCTTTAACTCGAGTTAAAGAGGTCAGAGCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032164.2-1043s1c1
Sequence:CCGGCCTTGTTCTATGTCAGCACATCTCGAGATGTGCTGACATAGAACAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032164.2-969s1c1
Sequence:CCGGGTCAATAAGAATGGTTCCATACTCGAGTATGGAACCATTCTTATTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_032164.2-1217s1c1
Sequence:CCGGCCATGAAGAAAGACCTTATAACTCGAGTTATAAGGTCTTTCTTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_032164.2-1465s1c1
Sequence:CCGGCCCACAGTAGAGACAAACATTCTCGAGAATGTTTGTCTCTACTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032164.2-1441s1c1
Sequence:CCGGCACACCTAAATCGTCATCAAACTCGAGTTTGATGACGATTTAGGTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032164
VALIDATED
ZNF394 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 394
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_032164.2-773s21c1
Sequence:CCGGGTTGATTCCAATGCAACAAATCTCGAGATTTGTTGCATTGGAATCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032164.2-1217s21c1
Sequence:CCGGCCATGAAGAAAGACCTTATAACTCGAGTTATAAGGTCTTTCTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_032164.2-1265s21c1
Sequence:CCGGACAACGCTCTGACCTCTTTAGCTCGAGCTAAAGAGGTCAGAGCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032164.2-957s21c1
Sequence:GTACCGGAGCATCTCAGATGTCAATAAGCTCGAGCTTATTGACATCTGAGATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_032164.2-1598s21c1
Sequence:CCGGACAGCGCTCTGACCTCTTTAACTCGAGTTAAAGAGGTCAGAGCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032164.2-1043s1c1
Sequence:CCGGCCTTGTTCTATGTCAGCACATCTCGAGATGTGCTGACATAGAACAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032164.2-969s1c1
Sequence:CCGGGTCAATAAGAATGGTTCCATACTCGAGTATGGAACCATTCTTATTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_032164.2-1217s1c1
Sequence:CCGGCCATGAAGAAAGACCTTATAACTCGAGTTATAAGGTCTTTCTTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_032164.2-1465s1c1
Sequence:CCGGCCCACAGTAGAGACAAACATTCTCGAGAATGTTTGTCTCTACTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032164.2-1441s1c1
Sequence:CCGGCACACCTAAATCGTCATCAAACTCGAGTTTGATGACGATTTAGGTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032164
VALIDATED
ZNF394 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 394
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_032164.2-773s21c1
Sequence:CCGGGTTGATTCCAATGCAACAAATCTCGAGATTTGTTGCATTGGAATCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032164.2-1217s21c1
Sequence:CCGGCCATGAAGAAAGACCTTATAACTCGAGTTATAAGGTCTTTCTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_032164.2-1265s21c1
Sequence:CCGGACAACGCTCTGACCTCTTTAGCTCGAGCTAAAGAGGTCAGAGCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032164.2-957s21c1
Sequence:GTACCGGAGCATCTCAGATGTCAATAAGCTCGAGCTTATTGACATCTGAGATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_032164.2-1598s21c1
Sequence:CCGGACAGCGCTCTGACCTCTTTAACTCGAGTTAAAGAGGTCAGAGCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032164.2-1043s1c1
Sequence:CCGGCCTTGTTCTATGTCAGCACATCTCGAGATGTGCTGACATAGAACAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032164.2-969s1c1
Sequence:CCGGGTCAATAAGAATGGTTCCATACTCGAGTATGGAACCATTCTTATTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_032164.2-1217s1c1
Sequence:CCGGCCATGAAGAAAGACCTTATAACTCGAGTTATAAGGTCTTTCTTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_032164.2-1465s1c1
Sequence:CCGGCCCACAGTAGAGACAAACATTCTCGAGAATGTTTGTCTCTACTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032164.2-1441s1c1
Sequence:CCGGCACACCTAAATCGTCATCAAACTCGAGTTTGATGACGATTTAGGTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks