EMAIL THIS PAGE TO A FRIEND

ZNF395

zinc finger protein 395

Synonyms: HDBP-2 HDBP2 HDRF-2 PBF PRF-1 PRF1 Si-1-8-14
Gene ID:
naked mole-rat(101724539) zinc finger protein 395
domestic guinea pig(100736169) zinc finger protein 395
cow(509082) zinc finger protein 395
sheep(101108553) zinc finger protein 395
Zebrafish(378872) zinc finger protein 395
chicken(422017) zinc finger protein 395
Horse(100061085) zinc finger protein 395
domestic cat(101095007) zinc finger protein 395
dog(486094) zinc finger protein 395
Zebrafish(100150763) zinc finger protein 395
87 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018660 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018660 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018660 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU096171 MISSION® esiRNA esiRNA human ZNF395 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018660 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018660 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058771 predicted 568
2 SASI_Hs01_00058772 predicted 1390
3 SASI_Hs01_00058774 predicted 1785
4 SASI_Hs01_00058775 predicted 1495
5 SASI_Hs01_00058776 predicted 982
6 SASI_Hs01_00058777 predicted 973
7 SASI_Hs01_00058778 predicted 1905
8 SASI_Hs01_00058779 predicted 1564
9 SASI_Hs01_00058780 predicted 1055
10 SASI_Hs02_00352163 predicted 721
11 SASI_Hs01_00058773 predicted 1918
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018660
VALIDATED
ZNF395 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 395
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148383    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018660.2-3749s1c1
Sequence:CCGGCCGTGTAGATATAACTGGATACTCGAGTATCCAGTTATATCTACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183104    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018660.2-3750s1c1
Sequence:CCGGCGTGTAGATATAACTGGATATCTCGAGATATCCAGTTATATCTACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018660.2-360s1c1
Sequence:CCGGGCAGAAGGTTTATGTGTGGTACTCGAGTACCACACATAAACCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018660.2-945s1c1
Sequence:CCGGGAACTCTGTGAAGGTGATGTACTCGAGTACATCACCTTCACAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018660.2-576s1c1
Sequence:CCGGCAGGAACATCGATGTCCCAAACTCGAGTTTGGGACATCGATGTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233234    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018660.2-2590s21c1
Sequence:CCGGCAGAAGCCTTTACTGATTAAACTCGAGTTTAATCAGTAAAGGCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018660.2-1226s21c1
Sequence:CCGGTTCCACCACCTCTGCACAAAGCTCGAGCTTTGTGCAGAGGTGGTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018660.2-1490s21c1
Sequence:CCGGAGCCAGCACCTGCGATGAAATCTCGAGATTTCATCGCAGGTGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018660.2-1013s21c1
Sequence:CCGGGCATCAAACGACACGTCAAAGCTCGAGCTTTGACGTGTCGTTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018660.2-294s21c1
Sequence:CCGGGCAGCCCAAGGAAGTCCTTAACTCGAGTTAAGGACTTCCTTGGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018660
VALIDATED
ZNF395 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 395
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148383    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018660.2-3749s1c1
Sequence:CCGGCCGTGTAGATATAACTGGATACTCGAGTATCCAGTTATATCTACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183104    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018660.2-3750s1c1
Sequence:CCGGCGTGTAGATATAACTGGATATCTCGAGATATCCAGTTATATCTACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018660.2-360s1c1
Sequence:CCGGGCAGAAGGTTTATGTGTGGTACTCGAGTACCACACATAAACCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018660.2-945s1c1
Sequence:CCGGGAACTCTGTGAAGGTGATGTACTCGAGTACATCACCTTCACAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018660.2-576s1c1
Sequence:CCGGCAGGAACATCGATGTCCCAAACTCGAGTTTGGGACATCGATGTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233234    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018660.2-2590s21c1
Sequence:CCGGCAGAAGCCTTTACTGATTAAACTCGAGTTTAATCAGTAAAGGCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018660.2-1226s21c1
Sequence:CCGGTTCCACCACCTCTGCACAAAGCTCGAGCTTTGTGCAGAGGTGGTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018660.2-1490s21c1
Sequence:CCGGAGCCAGCACCTGCGATGAAATCTCGAGATTTCATCGCAGGTGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018660.2-1013s21c1
Sequence:CCGGGCATCAAACGACACGTCAAAGCTCGAGCTTTGACGTGTCGTTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018660.2-294s21c1
Sequence:CCGGGCAGCCCAAGGAAGTCCTTAACTCGAGTTAAGGACTTCCTTGGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018660
VALIDATED
ZNF395 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 395
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148383    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018660.2-3749s1c1
Sequence:CCGGCCGTGTAGATATAACTGGATACTCGAGTATCCAGTTATATCTACACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183104    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018660.2-3750s1c1
Sequence:CCGGCGTGTAGATATAACTGGATATCTCGAGATATCCAGTTATATCTACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018660.2-360s1c1
Sequence:CCGGGCAGAAGGTTTATGTGTGGTACTCGAGTACCACACATAAACCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018660.2-945s1c1
Sequence:CCGGGAACTCTGTGAAGGTGATGTACTCGAGTACATCACCTTCACAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018660.2-576s1c1
Sequence:CCGGCAGGAACATCGATGTCCCAAACTCGAGTTTGGGACATCGATGTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233234    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018660.2-2590s21c1
Sequence:CCGGCAGAAGCCTTTACTGATTAAACTCGAGTTTAATCAGTAAAGGCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018660.2-1226s21c1
Sequence:CCGGTTCCACCACCTCTGCACAAAGCTCGAGCTTTGTGCAGAGGTGGTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018660.2-1490s21c1
Sequence:CCGGAGCCAGCACCTGCGATGAAATCTCGAGATTTCATCGCAGGTGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018660.2-1013s21c1
Sequence:CCGGGCATCAAACGACACGTCAAAGCTCGAGCTTTGACGTGTCGTTTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018660.2-294s21c1
Sequence:CCGGGCAGCCCAAGGAAGTCCTTAACTCGAGTTAAGGACTTCCTTGGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks