EMAIL THIS PAGE TO A FRIEND

ZNF396

zinc finger protein 396

Synonyms: ZSCAN14
UniProtKB ID: Q96N95, A1L3V0, Q8NF98, Q8TD80
Gene ID:
domestic cat(101093719) zinc finger protein 396
dog(100684525) zinc finger protein 396
cow(101905653) zinc finger protein 396
domestic guinea pig(100732037) zinc finger protein 396
naked mole-rat(101707877) zinc finger protein 396
66 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145756 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145756 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145756 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU008341 MISSION® esiRNA esiRNA targeting human ZNF396 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145756 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145756 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133070 predicted 1213
2 SASI_Hs02_00365343 predicted 733
3 SASI_Hs01_00133071 predicted 960
4 SASI_Hs01_00133072 predicted 804
5 SASI_Hs01_00133073 predicted 828
6 SASI_Hs01_00133074 predicted 989
7 SASI_Hs02_00365344 predicted 669
8 SASI_Hs01_00133075 predicted 1221
9 SASI_Hs01_00133076 predicted 775
10 SASI_Hs01_00133077 predicted 1002
11 SASI_Hs01_00133078 predicted 1172
12 SASI_Hs01_00133079 predicted 973
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145756
ZNF396 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 396
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145756.2-560s21c1
Sequence:CCGGGACGAAGGAAGGACATGATTGCTCGAGCAATCATGTCCTTCCTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145756.2-1475s21c1
Sequence:CCGGCCGTAACTGCTGATGACAATACTCGAGTATTGTCATCAGCAGTTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145756.2-991s21c1
Sequence:CCGGGCATTCAGCCGAAGCGCAATTCTCGAGAATTGCGCTTCGGCTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420799    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145756.2-1160s21c1
Sequence:CCGGCACAAGAGCCTCCATACTATTCTCGAGAATAGTATGGAGGCTCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145756.1-688s1c1
Sequence:CCGGCCACATGATGAAGACATCAAACTCGAGTTTGATGTCTTCATCATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145756.1-170s1c1
Sequence:CCGGCACAAACTTCAGAGGAGTGTACTCGAGTACACTCCTCTGAAGTTTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145756.1-1083s1c1
Sequence:CCGGGTACTTCAAGACTAGGCTGAACTCGAGTTCAGCCTAGTCTTGAAGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145756.1-665s1c1
Sequence:CCGGCATGGGAGCTTCAGTCCTTAACTCGAGTTAAGGACTGAAGCTCCCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145756.1-808s1c1
Sequence:CCGGTCCACATATAGAGGAACCTATCTCGAGATAGGTTCCTCTATATGTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145756
ZNF396 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 396
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145756.2-560s21c1
Sequence:CCGGGACGAAGGAAGGACATGATTGCTCGAGCAATCATGTCCTTCCTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145756.2-1475s21c1
Sequence:CCGGCCGTAACTGCTGATGACAATACTCGAGTATTGTCATCAGCAGTTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145756.2-991s21c1
Sequence:CCGGGCATTCAGCCGAAGCGCAATTCTCGAGAATTGCGCTTCGGCTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420799    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145756.2-1160s21c1
Sequence:CCGGCACAAGAGCCTCCATACTATTCTCGAGAATAGTATGGAGGCTCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145756.1-688s1c1
Sequence:CCGGCCACATGATGAAGACATCAAACTCGAGTTTGATGTCTTCATCATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145756.1-170s1c1
Sequence:CCGGCACAAACTTCAGAGGAGTGTACTCGAGTACACTCCTCTGAAGTTTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145756.1-1083s1c1
Sequence:CCGGGTACTTCAAGACTAGGCTGAACTCGAGTTCAGCCTAGTCTTGAAGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145756.1-665s1c1
Sequence:CCGGCATGGGAGCTTCAGTCCTTAACTCGAGTTAAGGACTGAAGCTCCCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145756.1-808s1c1
Sequence:CCGGTCCACATATAGAGGAACCTATCTCGAGATAGGTTCCTCTATATGTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145756
ZNF396 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 396
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145756.2-560s21c1
Sequence:CCGGGACGAAGGAAGGACATGATTGCTCGAGCAATCATGTCCTTCCTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145756.2-1475s21c1
Sequence:CCGGCCGTAACTGCTGATGACAATACTCGAGTATTGTCATCAGCAGTTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145756.2-991s21c1
Sequence:CCGGGCATTCAGCCGAAGCGCAATTCTCGAGAATTGCGCTTCGGCTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420799    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145756.2-1160s21c1
Sequence:CCGGCACAAGAGCCTCCATACTATTCTCGAGAATAGTATGGAGGCTCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145756.1-688s1c1
Sequence:CCGGCCACATGATGAAGACATCAAACTCGAGTTTGATGTCTTCATCATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145756.1-170s1c1
Sequence:CCGGCACAAACTTCAGAGGAGTGTACTCGAGTACACTCCTCTGAAGTTTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145756.1-1083s1c1
Sequence:CCGGGTACTTCAAGACTAGGCTGAACTCGAGTTCAGCCTAGTCTTGAAGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145756.1-665s1c1
Sequence:CCGGCATGGGAGCTTCAGTCCTTAACTCGAGTTAAGGACTGAAGCTCCCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145756.1-808s1c1
Sequence:CCGGTCCACATATAGAGGAACCTATCTCGAGATAGGTTCCTCTATATGTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks