EMAIL THIS PAGE TO A FRIEND

ZNF397

zinc finger protein 397

Synonyms: ZNF47 ZSCAN15
UniProtKB ID: Q8NF99, Q9BRM2
Gene ID:
Human(84307) Summary: This gene encodes a protein with a N-terminal SCAN domain, and the longer isoform contains nine C2H2-type zinc finger repeats in the C-terminal domain. The protein localizes to centromeres during interphase and early prophase, and different isoforms can repress or activate transcription in transfection studies. Multiple transcript variants encoding different isoforms have been found for this gene. Additional variants have been described, but their biological validity has not been determined. [provided by RefSeq, Oct 2009]
naked mole-rat(101707504) zinc finger protein 397
domestic guinea pig(100735295) zinc finger protein 397
cow(506448) zinc finger protein 397
sheep(101110376) zinc finger protein 397
dog(100686871) zinc finger protein 397
domestic cat(101093968) zinc finger protein 397
Horse(100052677) zinc finger protein 397
44 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032347 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032347 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032347 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU067241 MISSION® esiRNA esiRNA human ZNF397 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032347 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032347 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012924 predicted 385
2 SASI_Hs01_00012927 predicted 390
3 SASI_Hs01_00012928 predicted 248
4 SASI_Hs01_00012929 predicted 273
5 SASI_Hs01_00012930 predicted 272
6 SASI_Hs01_00012931 predicted 444
7 SASI_Hs01_00012932 predicted 264
8 SASI_Hs02_00359735 predicted 369
9 SASI_Hs02_00359736 predicted 451
10 SASI_Hs01_00012925 predicted 499
11 SASI_Hs01_00012926 predicted 457
12 SASI_Hs01_00012933 predicted 235
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032347
VALIDATED
ZNF397 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 397
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_032347.1-639s1c1
Sequence:CCGGGCCCTTAAAGACACAGCTGAACTCGAGTTCAGCTGTGTCTTTAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032347.1-184s1c1
Sequence:CCGGCCGGAACAAGAACTAATACTACTCGAGTAGTATTAGTTCTTGTTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_032347.1-699s1c1
Sequence:CCGGGAACAGTGAAACAGCAACAAACTCGAGTTTGTTGCTGTTTCACTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032347.1-511s1c1
Sequence:CCGGGAGGATTTAGAGAGGGAGTTTCTCGAGAAACTCCCTCTCTAAATCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032347.1-181s21c1
Sequence:CCGGCCTCCGGAACAAGAACTAATACTCGAGTATTAGTTCTTGTTCCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032347.1-246s21c1
Sequence:CCGGGCAGAATGGGAGTACTCAATCCTCGAGGATTGAGTACTCCCATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032347.1-961s21c1
Sequence:CCGGTGAAGAACACATCGTCAATAACTCGAGTTATTGACGATGTGTTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232318    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032347.1-1266s21c1
Sequence:CCGGGCCATGGGACCACGCATAAATCTCGAGATTTATGCGTGGTCCCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032347.1-575s21c1
Sequence:CCGGCAGTGCCATGGAAGGATTTAACTCGAGTTAAATCCTTCCATGGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032347
VALIDATED
ZNF397 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 397
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_032347.1-639s1c1
Sequence:CCGGGCCCTTAAAGACACAGCTGAACTCGAGTTCAGCTGTGTCTTTAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032347.1-184s1c1
Sequence:CCGGCCGGAACAAGAACTAATACTACTCGAGTAGTATTAGTTCTTGTTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_032347.1-699s1c1
Sequence:CCGGGAACAGTGAAACAGCAACAAACTCGAGTTTGTTGCTGTTTCACTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032347.1-511s1c1
Sequence:CCGGGAGGATTTAGAGAGGGAGTTTCTCGAGAAACTCCCTCTCTAAATCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032347.1-181s21c1
Sequence:CCGGCCTCCGGAACAAGAACTAATACTCGAGTATTAGTTCTTGTTCCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032347.1-246s21c1
Sequence:CCGGGCAGAATGGGAGTACTCAATCCTCGAGGATTGAGTACTCCCATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032347.1-961s21c1
Sequence:CCGGTGAAGAACACATCGTCAATAACTCGAGTTATTGACGATGTGTTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232318    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032347.1-1266s21c1
Sequence:CCGGGCCATGGGACCACGCATAAATCTCGAGATTTATGCGTGGTCCCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032347.1-575s21c1
Sequence:CCGGCAGTGCCATGGAAGGATTTAACTCGAGTTAAATCCTTCCATGGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032347
VALIDATED
ZNF397 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 397
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_032347.1-639s1c1
Sequence:CCGGGCCCTTAAAGACACAGCTGAACTCGAGTTCAGCTGTGTCTTTAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032347.1-184s1c1
Sequence:CCGGCCGGAACAAGAACTAATACTACTCGAGTAGTATTAGTTCTTGTTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_032347.1-699s1c1
Sequence:CCGGGAACAGTGAAACAGCAACAAACTCGAGTTTGTTGCTGTTTCACTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032347.1-511s1c1
Sequence:CCGGGAGGATTTAGAGAGGGAGTTTCTCGAGAAACTCCCTCTCTAAATCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032347.1-181s21c1
Sequence:CCGGCCTCCGGAACAAGAACTAATACTCGAGTATTAGTTCTTGTTCCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032347.1-246s21c1
Sequence:CCGGGCAGAATGGGAGTACTCAATCCTCGAGGATTGAGTACTCCCATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032347.1-961s21c1
Sequence:CCGGTGAAGAACACATCGTCAATAACTCGAGTTATTGACGATGTGTTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232318    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032347.1-1266s21c1
Sequence:CCGGGCCATGGGACCACGCATAAATCTCGAGATTTATGCGTGGTCCCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032347.1-575s21c1
Sequence:CCGGCAGTGCCATGGAAGGATTTAACTCGAGTTAAATCCTTCCATGGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks