EMAIL THIS PAGE TO A FRIEND

ZNF398

zinc finger protein 398

Synonyms: P51 P71 ZER6
UniProtKB ID: Q8TD17, A8K384, B4E377, Q8TD18, Q9P2K7, Q9UDV8
Gene ID:
Human(57541) Summary: This gene encodes a member of the Kruppel family of C2H2-type zinc-finger transcription factor proteins. The encoded protein acts as a transcriptional activator. Two transcript variants encoding distinct isoforms have been identified for this gene. Other transcript variants have been described, but their full length sequence has not been determined. [provided by RefSeq, Jul 2008]
chicken(769032) zinc finger protein 398
dog(100687206) zinc finger protein 398
Horse(100060738) zinc finger protein 398
domestic cat(101089091) zinc finger protein 398
cow(525559) zinc finger protein 398
sheep(101107348) zinc finger protein 398
domestic guinea pig(100734000) zinc finger protein 398
naked mole-rat(101699764) zinc finger protein 398
91 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020781 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020781 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020781 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020781 Rosetta Predictions human pricing
NM_170686 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020781 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105485 predicted 874
2 SASI_Hs01_00105486 predicted 2556
3 SASI_Hs01_00105488 predicted 2400
4 SASI_Hs01_00105489 predicted 1574
5 SASI_Hs01_00105490 predicted 2666
6 SASI_Hs01_00105491 predicted 2354
7 SASI_Hs01_00105492 predicted 2519
8 SASI_Hs01_00105493 predicted 1883
9 SASI_Hs01_00105494 predicted 2595
10 SASI_Hs02_00353938 predicted 2674
11 SASI_Hs01_00105487 predicted 2359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170686 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367616 predicted 546
2 SASI_Hs01_00219452 predicted 553
3 SASI_Hs02_00367617 predicted 1053
4 SASI_Hs01_00219456 predicted 1249
5 SASI_Hs01_00219457 predicted 2018
6 SASI_Hs02_00367618 predicted 665
7 SASI_Hs02_00367619 predicted 1095
8 SASI_Hs01_00219459 predicted 265
9 SASI_Hs01_00219460 predicted 1560
10 SASI_Hs02_00367620 predicted 821
11 SASI_Hs01_00219453 predicted 2242
12 SASI_Hs01_00219454 predicted 2037
13 SASI_Hs01_00219455 predicted 2081
14 SASI_Hs01_00219458 predicted 453
15 SASI_Hs01_00219461 predicted 1750
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020781
VALIDATED
ZNF398 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 398
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000233289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020781.2-879s21c1
Sequence:CCGGTCCATGGATTATGCTATAAATCTCGAGATTTATAGCATAATCCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020781.2-992s21c1
Sequence:CCGGCAGTGAAGAGCCTGGTATTTCCTCGAGGAAATACCAGGCTCTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020781.2-1983s21c1
Sequence:CCGGATCCGCAAGCACCACCTAATGCTCGAGCATTAGGTGGTGCTTGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020781.2-1581s21c1
Sequence:CCGGTACCATCTTCGGGTCCATAACCTCGAGGTTATGGACCCGAAGATGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020781.2-2853s21c1
Sequence:CCGGGCCTAGGTTTCTTAGATTAATCTCGAGATTAATCTAAGAAACCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020781.2-2167s1c1
Sequence:CCGGCCCTCATAACTGGGCTTGAAACTCGAGTTTCAAGCCCAGTTATGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020781.2-991s1c1
Sequence:CCGGCCAGTGAAGAGCCTGGTATTTCTCGAGAAATACCAGGCTCTTCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020781.2-1579s1c1
Sequence:CCGGCCTACCATCTTCGGGTCCATACTCGAGTATGGACCCGAAGATGGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020781.2-1997s1c1
Sequence:CCGGCCTAATGAAACACCAGCGCATCTCGAGATGCGCTGGTGTTTCATTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020781.2-903s1c1
Sequence:CCGGCCTGATGTCTTATCTCAGATTCTCGAGAATCTGAGATAAGACATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020781
VALIDATED
ZNF398 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 398
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000233289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020781.2-879s21c1
Sequence:CCGGTCCATGGATTATGCTATAAATCTCGAGATTTATAGCATAATCCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020781.2-992s21c1
Sequence:CCGGCAGTGAAGAGCCTGGTATTTCCTCGAGGAAATACCAGGCTCTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020781.2-1983s21c1
Sequence:CCGGATCCGCAAGCACCACCTAATGCTCGAGCATTAGGTGGTGCTTGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020781.2-1581s21c1
Sequence:CCGGTACCATCTTCGGGTCCATAACCTCGAGGTTATGGACCCGAAGATGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020781.2-2853s21c1
Sequence:CCGGGCCTAGGTTTCTTAGATTAATCTCGAGATTAATCTAAGAAACCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020781.2-2167s1c1
Sequence:CCGGCCCTCATAACTGGGCTTGAAACTCGAGTTTCAAGCCCAGTTATGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020781.2-991s1c1
Sequence:CCGGCCAGTGAAGAGCCTGGTATTTCTCGAGAAATACCAGGCTCTTCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020781.2-1579s1c1
Sequence:CCGGCCTACCATCTTCGGGTCCATACTCGAGTATGGACCCGAAGATGGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020781.2-1997s1c1
Sequence:CCGGCCTAATGAAACACCAGCGCATCTCGAGATGCGCTGGTGTTTCATTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020781.2-903s1c1
Sequence:CCGGCCTGATGTCTTATCTCAGATTCTCGAGAATCTGAGATAAGACATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020781
VALIDATED
ZNF398 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 398
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000233289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020781.2-879s21c1
Sequence:CCGGTCCATGGATTATGCTATAAATCTCGAGATTTATAGCATAATCCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020781.2-992s21c1
Sequence:CCGGCAGTGAAGAGCCTGGTATTTCCTCGAGGAAATACCAGGCTCTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020781.2-1983s21c1
Sequence:CCGGATCCGCAAGCACCACCTAATGCTCGAGCATTAGGTGGTGCTTGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020781.2-1581s21c1
Sequence:CCGGTACCATCTTCGGGTCCATAACCTCGAGGTTATGGACCCGAAGATGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020781.2-2853s21c1
Sequence:CCGGGCCTAGGTTTCTTAGATTAATCTCGAGATTAATCTAAGAAACCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020781.2-2167s1c1
Sequence:CCGGCCCTCATAACTGGGCTTGAAACTCGAGTTTCAAGCCCAGTTATGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020781.2-991s1c1
Sequence:CCGGCCAGTGAAGAGCCTGGTATTTCTCGAGAAATACCAGGCTCTTCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020781.2-1579s1c1
Sequence:CCGGCCTACCATCTTCGGGTCCATACTCGAGTATGGACCCGAAGATGGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020781.2-1997s1c1
Sequence:CCGGCCTAATGAAACACCAGCGCATCTCGAGATGCGCTGGTGTTTCATTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_020781.2-903s1c1
Sequence:CCGGCCTGATGTCTTATCTCAGATTCTCGAGAATCTGAGATAAGACATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks