EMAIL THIS PAGE TO A FRIEND

ZNF3

zinc finger protein 3

Synonyms: A8-51 HF.12 KOX25 PP838 Zfp113
Gene ID:
Horse(100067274) zinc finger protein 3
cow(618141) zinc finger protein 3
sheep(101110990) zinc finger protein 3
Goat(100861049) zinc finger protein 3
domestic guinea pig(100720971) zinc finger protein 3
naked mole-rat(101698312) zinc finger protein 3
Domestic Rabbit(100344364) zinc finger protein 3
114 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017715 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017715 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017715 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU117751 MISSION® esiRNA esiRNA human ZNF3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017715 Rosetta Predictions human pricing
NM_032924 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017715 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350480 predicted 845
2 SASI_Hs01_00084396 predicted 563
3 SASI_Hs02_00350481 predicted 769
4 SASI_Hs02_00350482 predicted 863
5 SASI_Hs01_00084397 predicted 323
6 SASI_Hs02_00350483 predicted 918
7 SASI_Hs02_00350484 predicted 568
8 SASI_Hs02_00350485 predicted 800
9 SASI_Hs02_00350486 predicted 788
10 SASI_Hs02_00350487 predicted 942
11 SASI_Hs01_00084389 predicted 623
12 SASI_Hs01_00084390 predicted 593
13 SASI_Hs01_00084391 predicted 688
14 SASI_Hs01_00084392 predicted 450
15 SASI_Hs01_00084393 predicted 565
16 SASI_Hs01_00084394 predicted 338
17 SASI_Hs01_00084395 predicted 612
18 SASI_Hs01_00084398 predicted 1176
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032924 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139615 predicted 918
2 SASI_Hs01_00139620 predicted 1606
3 SASI_Hs01_00139621 predicted 1569
4 SASI_Hs01_00139622 predicted 1710
5 SASI_Hs02_00360534 predicted 558
6 SASI_Hs02_00360535 predicted 313
7 SASI_Hs02_00360536 predicted 1424
8 SASI_Hs02_00360537 predicted 1701
9 SASI_Hs01_00139619 predicted 851
10 SASI_Hs01_00139613 predicted 864
11 SASI_Hs01_00139614 predicted 798
12 SASI_Hs01_00139616 predicted 657
13 SASI_Hs01_00139617 predicted 779
14 SASI_Hs01_00139618 predicted 539
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017715
ZNF3 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017715.2-483s21c1
Sequence:CCGGGTGTACTTCATCCGGAAGGAGCTCGAGCTCCTTCCGGATGAAGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017715.2-573s21c1
Sequence:CCGGTTCTCACTGGACTGGATACACCTCGAGGTGTATCCAGTCCAGTGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017715.2-430s21c1
Sequence:CCGGCTGCGCTCCTAAAGGCCAAGTCTCGAGACTTGGCCTTTAGGAGCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017715.2-352s21c1
Sequence:CCGGCCCTGCTTGACAGTGCTCTTCCTCGAGGAAGAGCACTGTCAAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017715.2-506s21c1
Sequence:CCGGGAAGCGTTTGGAACCTGCTCACTCGAGTGAGCAGGTTCCAAACGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017715.1-1271s1c1
Sequence:CCGGCCACCAAGTGTGTTCTGTAATCTCGAGATTACAGAACACACTTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017715.1-1039s1c1
Sequence:CCGGCCCTTATTCACCATCAGAGAACTCGAGTTCTCTGATGGTGAATAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017715.1-1161s1c1
Sequence:CCGGGCCACAATCTTTGCACTGATACTCGAGTATCAGTGCAAAGATTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017715.1-679s1c1
Sequence:CCGGGCAAGAGCTTTAATCGAACTTCTCGAGAAGTTCGATTAAAGCTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017715.1-658s1c1
Sequence:CCGGCCCATAAGTGTGATGAATGTACTCGAGTACATTCATCACACTTATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017715
ZNF3 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017715.2-483s21c1
Sequence:CCGGGTGTACTTCATCCGGAAGGAGCTCGAGCTCCTTCCGGATGAAGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017715.2-573s21c1
Sequence:CCGGTTCTCACTGGACTGGATACACCTCGAGGTGTATCCAGTCCAGTGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017715.2-430s21c1
Sequence:CCGGCTGCGCTCCTAAAGGCCAAGTCTCGAGACTTGGCCTTTAGGAGCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017715.2-352s21c1
Sequence:CCGGCCCTGCTTGACAGTGCTCTTCCTCGAGGAAGAGCACTGTCAAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017715.2-506s21c1
Sequence:CCGGGAAGCGTTTGGAACCTGCTCACTCGAGTGAGCAGGTTCCAAACGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017715.1-1271s1c1
Sequence:CCGGCCACCAAGTGTGTTCTGTAATCTCGAGATTACAGAACACACTTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017715.1-1039s1c1
Sequence:CCGGCCCTTATTCACCATCAGAGAACTCGAGTTCTCTGATGGTGAATAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017715.1-1161s1c1
Sequence:CCGGGCCACAATCTTTGCACTGATACTCGAGTATCAGTGCAAAGATTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017715.1-679s1c1
Sequence:CCGGGCAAGAGCTTTAATCGAACTTCTCGAGAAGTTCGATTAAAGCTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017715.1-658s1c1
Sequence:CCGGCCCATAAGTGTGATGAATGTACTCGAGTACATTCATCACACTTATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017715
ZNF3 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017715.2-483s21c1
Sequence:CCGGGTGTACTTCATCCGGAAGGAGCTCGAGCTCCTTCCGGATGAAGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017715.2-573s21c1
Sequence:CCGGTTCTCACTGGACTGGATACACCTCGAGGTGTATCCAGTCCAGTGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017715.2-430s21c1
Sequence:CCGGCTGCGCTCCTAAAGGCCAAGTCTCGAGACTTGGCCTTTAGGAGCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017715.2-352s21c1
Sequence:CCGGCCCTGCTTGACAGTGCTCTTCCTCGAGGAAGAGCACTGTCAAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017715.2-506s21c1
Sequence:CCGGGAAGCGTTTGGAACCTGCTCACTCGAGTGAGCAGGTTCCAAACGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017715.1-1271s1c1
Sequence:CCGGCCACCAAGTGTGTTCTGTAATCTCGAGATTACAGAACACACTTGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017715.1-1039s1c1
Sequence:CCGGCCCTTATTCACCATCAGAGAACTCGAGTTCTCTGATGGTGAATAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017715.1-1161s1c1
Sequence:CCGGGCCACAATCTTTGCACTGATACTCGAGTATCAGTGCAAAGATTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017715.1-679s1c1
Sequence:CCGGGCAAGAGCTTTAATCGAACTTCTCGAGAAGTTCGATTAAAGCTCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017715.1-658s1c1
Sequence:CCGGCCCATAAGTGTGATGAATGTACTCGAGTACATTCATCACACTTATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks