EMAIL THIS PAGE TO A FRIEND

ZNF404

zinc finger protein 404

UniProtKB ID: Q494X3, A4FU30
Gene ID:
Horse(100070374) zinc finger protein 404
domestic cat(101089974) zinc finger protein 404
dog(612388) zinc finger protein 404
domestic guinea pig(101788136) zinc finger protein 404
cow(505067) zinc finger protein 404
sheep(101109204) zinc finger protein 404
18 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA032014 Anti-ZNF404 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2103243 Anti-ZNF404 antibody produced in rabbit affinity isolated antibody horse, rabbit, rat, guinea pig, bovine, canine, human, mouse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033719 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001033719 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001033719 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU148261 MISSION® esiRNA esiRNA human ZNF404 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033719 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033719 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145563 predicted 434
2 SASI_Hs01_00145565 predicted 1272
3 SASI_Hs01_00145566 predicted 262
4 SASI_Hs01_00145567 predicted 750
5 SASI_Hs01_00145568 predicted 225
6 SASI_Hs02_00308086 predicted 673
7 SASI_Hs01_00145569 predicted 435
8 SASI_Hs01_00145570 predicted 914
9 SASI_Hs01_00145571 predicted 389
10 SASI_Hs01_00145572 predicted 922
11 SASI_Hs01_00145564 predicted 1345
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033719
ZNF404 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 404
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033719.1-1507s1c1
Sequence:CCGGGCCTTTAATCGCAGTGATCGACTCGAGTCGATCACTGCGATTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033719.1-1271s1c1
Sequence:CCGGGAGACCTTAAGACACATCAATCTCGAGATTGATGTGTCTTAAGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033719.1-709s1c1
Sequence:CCGGCATGTTGGCTTGAAACCCTTTCTCGAGAAAGGGTTTCAAGCCAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033719.1-928s1c1
Sequence:CCGGCGCAGCTATCTACTTGTTGAACTCGAGTTCAACAAGTAGATAGCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033719.1-1516s1c1
Sequence:CCGGCGCAGTGATCGACTTACTCAACTCGAGTTGAGTAAGTCGATCACTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033719.1-919s1c1
Sequence:CCGGGCCTTTGTTCGCAGCTATCTACTCGAGTAGATAGCTGCGAACAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033719.1-1423s1c1
Sequence:CCGGGCCTTTCGTTCTATCTCAGGTCTCGAGACCTGAGATAGAACGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033719.1-1010s1c1
Sequence:CCGGGTAAGGGCTCAAGCCTTCTTACTCGAGTAAGAAGGCTTGAGCCCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219851    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033719.2-1671s1c1
Sequence:CCGGGCCTTTAGCCATGGCACATTTCTCGAGAAATGTGCCATGGCTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219852    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033719.2-1691s1c1
Sequence:CCGGTTTACTGTTGTCACTATTATGCTCGAGCATAATAGTGACAACAGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033719
ZNF404 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 404
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033719.1-1507s1c1
Sequence:CCGGGCCTTTAATCGCAGTGATCGACTCGAGTCGATCACTGCGATTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033719.1-1271s1c1
Sequence:CCGGGAGACCTTAAGACACATCAATCTCGAGATTGATGTGTCTTAAGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033719.1-709s1c1
Sequence:CCGGCATGTTGGCTTGAAACCCTTTCTCGAGAAAGGGTTTCAAGCCAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033719.1-928s1c1
Sequence:CCGGCGCAGCTATCTACTTGTTGAACTCGAGTTCAACAAGTAGATAGCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033719.1-1516s1c1
Sequence:CCGGCGCAGTGATCGACTTACTCAACTCGAGTTGAGTAAGTCGATCACTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033719.1-919s1c1
Sequence:CCGGGCCTTTGTTCGCAGCTATCTACTCGAGTAGATAGCTGCGAACAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033719.1-1423s1c1
Sequence:CCGGGCCTTTCGTTCTATCTCAGGTCTCGAGACCTGAGATAGAACGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033719.1-1010s1c1
Sequence:CCGGGTAAGGGCTCAAGCCTTCTTACTCGAGTAAGAAGGCTTGAGCCCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219851    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033719.2-1671s1c1
Sequence:CCGGGCCTTTAGCCATGGCACATTTCTCGAGAAATGTGCCATGGCTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219852    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033719.2-1691s1c1
Sequence:CCGGTTTACTGTTGTCACTATTATGCTCGAGCATAATAGTGACAACAGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033719
ZNF404 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 404
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033719.1-1507s1c1
Sequence:CCGGGCCTTTAATCGCAGTGATCGACTCGAGTCGATCACTGCGATTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033719.1-1271s1c1
Sequence:CCGGGAGACCTTAAGACACATCAATCTCGAGATTGATGTGTCTTAAGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033719.1-709s1c1
Sequence:CCGGCATGTTGGCTTGAAACCCTTTCTCGAGAAAGGGTTTCAAGCCAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033719.1-928s1c1
Sequence:CCGGCGCAGCTATCTACTTGTTGAACTCGAGTTCAACAAGTAGATAGCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033719.1-1516s1c1
Sequence:CCGGCGCAGTGATCGACTTACTCAACTCGAGTTGAGTAAGTCGATCACTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033719.1-919s1c1
Sequence:CCGGGCCTTTGTTCGCAGCTATCTACTCGAGTAGATAGCTGCGAACAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033719.1-1423s1c1
Sequence:CCGGGCCTTTCGTTCTATCTCAGGTCTCGAGACCTGAGATAGAACGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033719.1-1010s1c1
Sequence:CCGGGTAAGGGCTCAAGCCTTCTTACTCGAGTAAGAAGGCTTGAGCCCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219851    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033719.2-1671s1c1
Sequence:CCGGGCCTTTAGCCATGGCACATTTCTCGAGAAATGTGCCATGGCTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219852    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033719.2-1691s1c1
Sequence:CCGGTTTACTGTTGTCACTATTATGCTCGAGCATAATAGTGACAACAGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks